NBL1 (NM_001278165) Human Untagged Clone
CAT#: SC334220
NBL1 (untagged) - Human neuroblastoma 1, DAN family BMP antagonist (NBL1), transcript variant 7
"NM_001278165" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NBL1 |
Synonyms | D1S1733E; DAN; DAND1; NB; NO3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC334220 representing NM_001278165.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATGCTTCGGGTCCTGGTGGGGGCTGTCCTCCCTGCCATGCTACTGGCTGCCCCACCACCCATCAAC AAGCTGGCACTGTTCCCAGATAAGAGTGCCTGGTGCGAAGCCAAGAACATCACCCAGATCGTGGGCCAC AGCGGCTGTGAGGCCAAGTCCATCCAGAACAGGGCGTGCCTAGGACAGTGCTTCAGCTACAGCGTCCCC AACACCTTCCCACAGTCCACAGAGTCCCTGGTTCACTGTGACTCCTGCATGCCAGCCCAGTCCATGTGG GAGATTGTGACGCTGGAGTGCCCGGGCCACGAGGAGGTGCCCAGGGTGGACAAGCTGGTGGAGAAGATC CTGCACTGTAGCTGCCAGGCCTGCGGCAAGGAGCCTAGTCACGAGGGGCTGAGCGTCTATGTGCAGGGC GAGGACGGGCCGGGATCCCAGCCCGGCACCCACCCTCACCCCCATCCCCACCCCCATCCTGGCGGGCAG ACCCCTGAGCCCGAGGACCCCCCTGGGGCCCCCCACACAGAGGAAGAGGGGGCTGAGGACTGA |
Restriction Sites |
SgfI-MluI
Plasmid Map
![]() |
ACCN | NM_001278165 |
Insert Size | 546 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278165.1 |
RefSeq Size | 2127 bp |
RefSeq ORF | 546 bp |
Locus ID | 4681 |
UniProt ID | P41271 |
Cytogenetics | 1p36.13 |
Protein Families | Secreted Protein |
MW | 19.4 kDa |
Gene Summary | This gene product is the founding member of the evolutionarily conserved CAN (Cerberus and DAN) family of proteins, which contain a domain resembling the CTCK (C-terminal cystine knot-like) motif found in a number of signaling molecules. These proteins are secreted, and act as BMP (bone morphogenetic protein) antagonists by binding to BMPs and preventing them from interacting with their receptors. They may thus play an important role during growth and development. Alternatively spliced transcript variants have been identified for this gene. Read-through transcripts between this locus and the upstream mitochondrial inner membrane organizing system 1 gene (GeneID 440574) have been observed. [provided by RefSeq, May 2013] Transcript Variant: This variant (7) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2, 3, 4, 6, 7, and 8 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236326 | NBL1 (myc-DDK-tagged) - Human neuroblastoma 1, DAN family BMP antagonist (NBL1), transcript variant 7 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review