ISG20 (NM_001303233) Human Untagged Clone

CAT#: SC334222

ISG20 (untagged) - Human interferon stimulated exonuclease gene 20kDa (ISG20), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ISG20
• Synonyms: CD25; HEM45
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334222 representing NM_001303233.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCTGGGAGCCGTGAGGTGGTGGCCATGGACTGCGAGATGGTGGGGCTGGGGCCCCACCGGGAGAGT
  GGCCTGGCTCGTTGCAGCCTCGTGAACGTCCACGGTGCTGTGCTGTACGACAAGTTCATCCGGCCTGAG
  GGAGAGATCACCGATTACAGAACCCGGGTCAGCGGGGTCACCCCTCAGCACATGGTGGGGGCCACACCA
  TTTGCCGTGGCCAGGCTAGAGATCCTGCAGCTCCTGAAAGGCAAGCTGGTGGTGGGTCATGACCTGAAG
  CACGACTTCCAGGCACTGAAAGAGGACATGAGCGGCTACACAATCTACGACACGTCCACTGACAGGCTG
  TTGTGGCGTGAGGCCAAGCTGGACCACTGCAGGCGTGTCTCCCTGCGGGTGCTGAGTGAGCGCCTCCTA
  CACAAGAGCATCCAGAACAGCCTGCTTGGACACAGCTCGGTGGAAGATGCGAGGGCAACGATGGAGCTC
  TATCAAATCTCCCAGAGAATCCGAGCCCGCCGAGGGCTGCCCCGCCTGGCTGTGTCAGACTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303233
• Insert Size: 546 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303233.1
• RefSeq Size: 1447 bp
• RefSeq ORF: 546 bp
• Locus ID: 3669
• UniProt ID: Q96AZ6
• Cytogenetics: 15q26.1
• MW: 20.4 kDa
• Gene Summary: Interferon-induced antiviral exoribonuclease that acts on single-stranded RNA and also has minor activity towards single-stranded DNA. Exhibits antiviral activity against RNA viruses including hepatitis C virus (HCV), hepatitis A virus (HAV) and yellow fever virus (YFV) in an exonuclease-dependent manner. May also play additional roles in the maturation of snRNAs and rRNAs, and in ribosome biogenesis.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (a).