ISG20 (NM_001303234) Human Untagged Clone

CAT#: SC334223

ISG20 (untagged) - Human interferon stimulated exonuclease gene 20kDa (ISG20), transcript variant 3


  "NM_001303234" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-ISG20 Antibody
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ISG20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ISG20
Synonyms CD25; HEM45
Vector pCMV6-Entry
Sequence Data
>SC334223 representing NM_001303234.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGGGAGCCGTGAGGTGGTGGCCATGGACTGCGAGATGGTGGGGCTGGGGCCCCACCGGGAGAGT
GGCCTGGCTCGTTGCAGCCTCGTGAACGTCCACGGTGCTGTGCTGTACGACAAGTTCATCCGGCCTGAG
GGAGAGATCACCGATTACAGAACCCGGGTCAGCGGGGTCACCCCTCAGCACATGGTGGGGGCCACACCA
TTTGCCGTGGCCAGGCTAGAGATCCTGCAGCTCCTGAAAGGCAAGCTGGTGGTGGGTCATGACCTGAAG
CACGACTTCCAGGCACTGAAAGAGGACATGAGCGGCTACACAATCTACGACACGTCCACTGACAGGCTG
TTGTGGCGTGAGGCCAAGCTGGACCACTGCAGGCGTGTCTCCCTGCGGGTGCTGAGTGAGCGCCTCCTA
CACAAGAGCATCCAGAACAGCCTGCTTGGACACAGCTCGGTGGAAGATGCGAGGGCAACGATGGAGCTC
TATCAAATCTCCCAGAGAATCCGAGCCCGCCGAGGGCTGCCCCGCCTGGCTGTGTCAGACTGA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001303234
Insert Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303234.1
RefSeq Size 1573 bp
RefSeq ORF 546 bp
Locus ID 3669
UniProt ID Q96AZ6
Cytogenetics 15q26.1
MW 20.4 kDa
Gene Summary Interferon-induced antiviral exoribonuclease that acts on single-stranded RNA and also has minor activity towards single-stranded DNA. Exhibits antiviral activity against RNA viruses including hepatitis C virus (HCV), hepatitis A virus (HAV) and yellow fever virus (YFV) in an exonuclease-dependent manner. May also play additional roles in the maturation of snRNAs and rRNAs, and in ribosome biogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.