RHEBL1 (NM_001303126) Human Untagged Clone

CAT#: SC334232

RHEBL1 (untagged) - Human Ras homolog enriched in brain like 1 (RHEBL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RHEBL1
• Synonyms: RHEBL1c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334232 representing NM_001303126.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTGGATGGATGATTTGGATACAACTGTCACACTGCTCCCCACAGGGAAGACATCTTTGGCACATCAA
  TTTGTGGAAGGCGAGTTCTCGGAAGGCTACGATCCTACAGTGGAGAATACTTACAGCAAGATAGTGACT
  CTTGGCAAAGATGAGTTTCACCTACATCTGGTGGACACAGCAGGGCAGGATGAGTACAGCATTCTGCCC
  TATTCATTCATCATTGGGGTCCATGGTTATGTGCTTGTGTATTCTGTCACCTCTCTGCATAGCTTCCAA
  GTCATTGAGAGTCTGTACCAAAAGCTACATGAAGGCCATGGGAAAACCCGGGTGCCAGTGGTTCTAGTG
  GGGAACAAGGCAGATCTCTCTCCAGAGAGAGAGGTACAGGCAGTTGAAGGAAAGAAGCTGGCAGAGTCC
  TGGGGTGCGACATTTATGGAGTCATCTGCTCGAGAGAATCAGCTGACTCAAGGCATCTTCACCAAAGTC
  ATCCAGGAGATTGCCCGTGTGGAGAATTCCTATGGGCAAGAGCGTCGCTGCCATCTCATGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303126
• Insert Size: 546 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303126.1
• RefSeq Size: 1303 bp
• RefSeq ORF: 546 bp
• Locus ID: 121268
• UniProt ID: Q8TAI7
• Cytogenetics: 12q13.12
• MW: 20.4 kDa
• Gene Summary: Binds GTP and exhibits intrinsic GTPase activity. May activate NF-kappa-B-mediated gene transcription. Promotes signal transduction through MTOR, activates RPS6KB1, and is a downstream target of the small GTPase-activating proteins TSC1 and TSC2.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice junction in the 5' end of the coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.