NDUFA5 (NM_001291304) Human Untagged Clone

CAT#: SC334242

NDUFA5 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFA5
• Synonyms: B13; CI-13kB; CI-13KD-B; NUFM; UQOR13
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334242 representing NM_001291304.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGGTTTGACCTTGTTGTCCAGGCTGGTTTCAAACTCCTGAGTTCGAGCAATCTACCCACCCTTCAA
  AGTGTTGGGATCACAGATATTTTACCATTACAATATAGATGGAGATTTTCATCTATTAATAAAAGATGT
  TCTCTATTCACAAATGGAAATGGAGCAACAGTACACAATTTCTGCCCCAGAATTCATGGCTGGTGCAGA
  TGGAAATATTGGCATAGTTCCAGAGGAGTTAAAGGACTCACCCAGGCCGTACAGCTGAGGCTAAGAATA
  TTGTACACAAAGATTCTTGATGTTCTTGAGGAAATCCCTAAAAATGCAGCATATAGAAAGTATACAGAA
  CAGATTACAAATGAGAAGCTGGCTATGGTTAAAGCGGAACCAGATGTTAAAAAATTAGAAGACCAACTT
  CAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAACATGAACTAAATCTGGCAAGAAAAATGAGG
  GAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCTGCCGATCAGTGGAAATGGCCAATATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001291304
• Insert Size: 549 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291304.1
• RefSeq Size: 5776 bp
• RefSeq ORF: 549 bp
• Locus ID: 4698
• Cytogenetics: 7q31.32
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• MW: 21.2 kDa
• Gene Summary: This nuclear gene encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. The encoded protein localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (9) represents use of an alternate promoter, compared to variant 1. It contains an distinct 5' UTR and 5' coding region and initiates translation at an alternate start codon. The encoded isoform (6) is longer than isoform 1 and has a distinct N-terminus. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.