NDUFA5 (NM_001291304) Human Untagged Clone

CAT#: SC334242

NDUFA5 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 9


  "NM_001291304" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
NDUFA5 mouse monoclonal antibody, clone OTI1E8 (formerly 1E8)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "NDUFA5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDUFA5
Synonyms B13; CI-13kB; CI-13KD-B; NUFM; UQOR13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334242 representing NM_001291304.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGTTTGACCTTGTTGTCCAGGCTGGTTTCAAACTCCTGAGTTCGAGCAATCTACCCACCCTTCAA
AGTGTTGGGATCACAGATATTTTACCATTACAATATAGATGGAGATTTTCATCTATTAATAAAAGATGT
TCTCTATTCACAAATGGAAATGGAGCAACAGTACACAATTTCTGCCCCAGAATTCATGGCTGGTGCAGA
TGGAAATATTGGCATAGTTCCAGAGGAGTTAAAGGACTCACCCAGGCCGTACAGCTGAGGCTAAGAATA
TTGTACACAAAGATTCTTGATGTTCTTGAGGAAATCCCTAAAAATGCAGCATATAGAAAGTATACAGAA
CAGATTACAAATGAGAAGCTGGCTATGGTTAAAGCGGAACCAGATGTTAAAAAATTAGAAGACCAACTT
CAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAACATGAACTAAATCTGGCAAGAAAAATGAGG
GAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCTGCCGATCAGTGGAAATGGCCAATATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001291304
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291304.1
RefSeq Size 5776 bp
RefSeq ORF 549 bp
Locus ID 4698
Cytogenetics 7q31.32
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 21.2 kDa
Gene Summary This nuclear gene encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. The encoded protein localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (9) represents use of an alternate promoter, compared to variant 1. It contains an distinct 5' UTR and 5' coding region and initiates translation at an alternate start codon. The encoded isoform (6) is longer than isoform 1 and has a distinct N-terminus. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.