SPECC1L (NM_001254733) Human Untagged Clone

CAT#: SC334247

SPECC1L (untagged) - Human sperm antigen with calponin homology and coiled-coil domains 1-like (SPECC1L), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPECC1L
• Synonyms: CYTSA; GBBB2; OBLFC1; TBHS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334247 representing NM_001254733.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAAAGTGCCAAGACCCTCTCAGTGTCTCGACGAAGTAGTGAAGAAATGAAACGGGACATTTCTGCA
  CAGGAGGGAGCGTCGCCAGCCTCTCTGATGGCTATGGGAACCACGTCTCCACAGCTTTCCCTGTCCTCT
  TCTCCAACGGCATCTGTGACTCCCACCACCCGAAGCCGAATAAGAGAAGAAAGGAAAGACCCTCTCTCA
  GCATTGGCCAGAGAATATGGAGGATCAAAGAGGAACGCCTTGCTGAAGTGGTGTCAGAAGAAAACAGAA
  GGCTATCAGAATATTGACATTACAAACTTCAGCAGCAGCTGGAATGATGGGCTGGCCTTCTGTGCCCTC
  CTGCATACATATCTCCCTGCCCACATTCCATATCAAGAACTGAACAGCCAGGATAAGAGAAGGAACTTC
  ATGCTGGCTTTCCAGGCAGCTGAAAGTGTCGGCATCAAATCCACACTGGACATTAATGAAATGGTACGG
  ACTGAACGACCCGACTGGCAGAACGTGATGCTGTATGTGACGGCGATCTACAAGTACTTTGAGACCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001254733
• Insert Size: 552 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001254733.1
• RefSeq Size: 4231 bp
• RefSeq ORF: 552 bp
• Locus ID: 23384
• Cytogenetics: 22q11.23
• MW: 20.6 kDa
• Gene Summary: This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.