Cyclin T1 (CCNT1) (NM_001277842) Human Untagged Clone

CAT#: SC334265

CCNT1 (untagged) - Human cyclin T1 (CCNT1), transcript variant b


  "NM_001277842" in other vectors (1)

Reconstitution Protocol

USD 477.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal CCNT1 Antibody
    • 100 ug

USD 430.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CCNT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCNT1
Synonyms CCNT; CYCT1; HIVE1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334265 representing NM_001277842.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGGAGAGAGGAAGAACAACAACAAACGGTGGTATTTCACTCGAGAACAGCTGGAAAATAGCCCA
TCCCGTCGTTTTGGCGTGGACCCAGATAAAGAACTTTCTTATCGCCAGCAGGCGGCCAATCTGCTTCAG
GACATGGGGCAGCGTCTTAACGTCTCACAATTGACTATCAACACTGCTATAGTATACATGCATCGATTC
TACATGATTCAGTCCTTCACACAGTTCCCTGGAAATTCTGTGGCTCCAGCAGCCTTGTTTCTAGCAGCT
AAAGTGGAGGAGCAGCCCAAAAAATTGGAACATGTCATCAAGGTAGCACATACTTGTCTCCATCCTCAG
GAATCCCTTCCTGATACTAGAAGTGAGGCTTATTTGCAACAAGTTCAAGATCTGGTCATTTTAGAAAGC
ATAATTTTGCAGACTTTAGGCTTTGAACTAACAATTGATCACCCACATACTCATGTAGTAAAGTGCACT
CAACTTGTTCGAGCAAGCAAGGACTTAGCACAGACTTCTTACTTCATGGCAACCAACAGAACTGACACA
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001277842
Insert Size 555 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277842.1
RefSeq Size 6915 bp
RefSeq ORF 555 bp
Locus ID 904
UniProt ID O60563
Cytogenetics 12q13.11-q13.12
Protein Families Druggable Genome, Transcription Factors
MW 21.2 kDa
Gene Summary This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (b, also known as dE7 and CycT1b) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant a. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a. While this variant may be considered a candidate for nonsense-mediated decay, experimental evidence suggests that it is protein coding (PMID: 23569210 and PMID: 22692005). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.