CNOT8 (NM_001301075) Human Untagged Clone

CAT#: SC334279

CNOT8 (untagged) - Human CCR4-NOT transcription complex, subunit 8 (CNOT8), transcript variant 4


  "NM_001301075" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal CNOT8 Antibody (C-term)
    • 400 ul

USD 450.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CNOT8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CNOT8
Synonyms CAF1; Caf1b; CALIF; hCAF1; POP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334279 representing NM_001301075.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTACTCCCAGGATTCCATAGATCTCCTTGCTAACTCAGGACTACAGTTTCAGAAGCATGAAGAGGAA
GGGATTGACACACTGCACTTTGCAGAGCTGCTTATGACATCAGGAGTGGTTCTCTGTGACAATGTCAAA
TGGCTTTCATTTCATAGTGGCTATGATTTTGGCTATATGGTAAAGTTGCTTACAGATTCTCGTTTGCCA
GAAGAGGAACATGAATTCTTTCATATTCTGAACCTTTTCTTCCCATCCATTTATGATGTGAAATACCTG
ATGAAGAGCTGCAAAAATCTTAAGGGAGGTCTTCAGGAAGTTGCTGATCAGTTGGATTTGCAGAGGATT
GGAAGGCAGCACCAGGCAGGCTCAGACTCACTGCTGACAGGAATGGCTTTCTTTAGGATGAAAGAGTTG
TTTTTTGAGGACAGCATTGATGATGCCAAGTACTGTGGGCGGCTCTATGGCTTAGGCACAGGAGTGGCC
CAGAAGCAGAATGAGGATGTGGACTCTGCCCAGGAGAAGATGAGCATCCTGGCGATTATCAACAACATG
CAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001301075
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301075.1
RefSeq Size 2475 bp
RefSeq ORF 561 bp
Locus ID 9337
UniProt ID Q9UFF9
Cytogenetics 5q33.2
Protein Families Transcription Factors
Protein Pathways RNA degradation
MW 21.2 kDa
Gene Summary Has 3'-5' poly(A) exoribonuclease activity for synthetic poly(A) RNA substrate. Its function seems to be partially redundant with that of CNOT7. Catalytic component of the CCR4-NOT complex which is linked to various cellular processes including bulk mRNA degradation, miRNA-mediated repression, translational repression during translational initiation and general transcription regulation. During miRNA-mediated repression the complex seems also to act as translational repressor during translational initiation. Additional complex functions may be a consequence of its influence on mRNA expression. Associates with members of the BTG family such as TOB1 and BTG2 and is required for their anti-proliferative activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks an exon in the 5' region, which results in translation initiation at a downstream in-frame AUG, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 4, 5, 6, 7 and 8 encode the same isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.