CNOT8 (NM_001301080) Human Untagged Clone
CAT#: SC334281
CNOT8 (untagged) - Human CCR4-NOT transcription complex, subunit 8 (CNOT8), transcript variant 6
"NM_001301080" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNOT8 |
Synonyms | CAF1; Caf1b; CALIF; hCAF1; POP2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334281 representing NM_001301080.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTACTCCCAGGATTCCATAGATCTCCTTGCTAACTCAGGACTACAGTTTCAGAAGCATGAAGAGGAA GGGATTGACACACTGCACTTTGCAGAGCTGCTTATGACATCAGGAGTGGTTCTCTGTGACAATGTCAAA TGGCTTTCATTTCATAGTGGCTATGATTTTGGCTATATGGTAAAGTTGCTTACAGATTCTCGTTTGCCA GAAGAGGAACATGAATTCTTTCATATTCTGAACCTTTTCTTCCCATCCATTTATGATGTGAAATACCTG ATGAAGAGCTGCAAAAATCTTAAGGGAGGTCTTCAGGAAGTTGCTGATCAGTTGGATTTGCAGAGGATT GGAAGGCAGCACCAGGCAGGCTCAGACTCACTGCTGACAGGAATGGCTTTCTTTAGGATGAAAGAGTTG TTTTTTGAGGACAGCATTGATGATGCCAAGTACTGTGGGCGGCTCTATGGCTTAGGCACAGGAGTGGCC CAGAAGCAGAATGAGGATGTGGACTCTGCCCAGGAGAAGATGAGCATCCTGGCGATTATCAACAACATG CAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI Plasmid Map |
ACCN | NM_001301080 |
Insert Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301080.1 |
RefSeq Size | 2432 bp |
RefSeq ORF | 561 bp |
Locus ID | 9337 |
UniProt ID | Q9UFF9 |
Cytogenetics | 5q33.2 |
Protein Families | Transcription Factors |
Protein Pathways | RNA degradation |
MW | 21.2 kDa |
Gene Summary | Has 3'-5' poly(A) exoribonuclease activity for synthetic poly(A) RNA substrate. Its function seems to be partially redundant with that of CNOT7. Catalytic component of the CCR4-NOT complex which is linked to various cellular processes including bulk mRNA degradation, miRNA-mediated repression, translational repression during translational initiation and general transcription regulation. During miRNA-mediated repression the complex seems also to act as translational repressor during translational initiation. Additional complex functions may be a consequence of its influence on mRNA expression. Associates with members of the BTG family such as TOB1 and BTG2 and is required for their anti-proliferative activity.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) has an alternate splice site and lacks two internal exons in the 5' region, which results in translation initiation at a downstream in-frame AUG, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 4, 5, 6, 7 and 8 encode the same isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236387 | CNOT8 (myc-DDK-tagged) - Human CCR4-NOT transcription complex, subunit 8 (CNOT8), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review