C1RL (NM_001297643) Human Untagged Clone

CAT#: SC334295

C1RL (untagged) - Human complement component 1, r subcomponent-like (C1RL), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C1RL
• Synonyms: C1r-LP; C1RL1; C1RLP; CLSPa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334295 representing NM_001297643.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCTGGACCCAGAGTGTGGGGGAAATATCTCTGGAGAAGCCCTCACTCCAAAGGCTGTCCAGGCGCA
  ATGTGGTGGCTGCTTCTCTGGGGAGTCCTCCAGGCTTGCCCAACCCGGGGCTCCGTCCTCTTGGCCCAA
  GAGCTACCCCAGCAGCTGACATCCCCCGGGTACCCAGAGCCGTATGGCAAAGGCCAAGAGAGCAGCACG
  GACATCAAGGCTCCAGAGGGCTTTGCTGTGAGGCTCGTCTTCCAGGACTTCGACCTGGAGCCGTCCCAG
  GACTGTGCAGGGGACTCTGTCACAATCTCATTCGTCGGTTCGGATCCAAGCCAGTTCTGTGGTCAGCAA
  GGCTCCCCTCTGGGCAGGCCCCCTGGTCAGAGGGAGTTTGTATCCTCAGGGAGGAGTTTGCGGCTGACC
  TTCCGCACACAGCCTTCCTCGGAGAACAAGACTGCCCACCTCCACAAGGGCTTCCTGGCCCTCTACCAA
  ACCGTGGGTGAGTGTCCCTCCTGGGGGTGCAGGGAGGGAGCCTCTGTTCCCAGCCATGACCCTGGTATC
  TTCAAGCCTTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001297643
• Insert Size: 564 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297643.1
• RefSeq Size: 895 bp
• RefSeq ORF: 564 bp
• Locus ID: 51279
• Cytogenetics: 12p13.31
• Protein Families: Druggable Genome, Protease
• MW: 20.4 kDa
• Gene Summary: Mediates the proteolytic cleavage of HP/haptoglobin in the endoplasmic reticulum.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) is shorter, and has a distinct C-terminus, compared to isoform 1.