SURF1 (NM_001280787) Human Untagged Clone

CAT#: SC334324

SURF1 (untagged) - Human surfeit 1 (SURF1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SURF1
• Synonyms: CMT4K; MC4DN1; SHY1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334324 representing NM_001280787.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAACTGAAAAATCTGGAGTATAGGCCAGTGAAGGTCAGGGGGTGCTTTGACCATTCCAAGGAGCTG
  TATATGATGCCCCGGACCATGGTGGACCCTGTCCGGGAGGCCCGGGAGGGCGGCCTCATCTCCTCCTCA
  ACTCAGAGTGGGGCCTATGTGGTCACTCCCTTCCACTGCACCGACCTGGGAGTCACCATCCTGGTAAAT
  AGAGGGTTCGTTCCCAGGAAGAAAGTGAATCCTGAAACCCGGCAGAAAGGCCAGATTGAGGGAGAAGTG
  GACCTCATTGGGATGGTGAGGCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAACAATCCAGAAAGG
  AACCACTGGCATTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGCGCAGAGCCCATCTTCATTGAT
  GCCAACTTCCAGAGCACAGTCCCTGGAGGACCCATTGGAGGGCAAACCAGAGTTACTCTGAGGAACGAG
  CATCTGCAGTACATCGTGACCTGGTATGGACTCTCTGCAGCTACATCCTACCTGTGGTTTAAGAAATTC
  CTACGTGGGACACCTGGTGTGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001280787
• Insert Size: 576 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001280787.1
• RefSeq Size: 994 bp
• RefSeq ORF: 576 bp
• Locus ID: 6834
• UniProt ID: Q15526
• Cytogenetics: 9q34.2
• Protein Families: Druggable Genome
• MW: 21.7 kDa
• Gene Summary: This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an exon in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.