RHOH (NM_001278369) Human Untagged Clone

CAT#: SC334341

RHOH (untagged) - Human ras homolog family member H (RHOH), transcript variant 12


  "NM_001278369" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
RHOH mouse monoclonal antibody,clone OTI9F4
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "RHOH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RHOH
Synonyms ARHH; TTF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334341 representing NM_001278369.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGAGTTCCATCAAGTGCGTGTTGGTGGGCGACTCTGCTGTGGGGAAAACCTCTCTGTTGGTGCGC
TTCACCTCCGAGACCTTCCCGGAGGCCTACAAGCCCACAGTGTACGAGAACACAGGGGTGGACGTCTTC
ATGGATGGCATCCAGATCAGCCTGGGCCTCTGGGACACAGCCGGCAATGACGCCTTCAGAAGCATCCGG
CCCCTGTCCTACCAGCAGGCAGACGTGGTGCTGATGTGCTACTCTGTGGCCAACCATAACTCATTCCTG
AACTTGAAGAACAAGTGGATTGGTGAAATTAGGAGCAACTTGCCCTGTACCCCTGTGCTGGTGGTGGCC
ACCCAGACTGACCAGCGGGAGATGGGGCCCCACAGGGCCTCCTGCGTCAATGCCATGGAAGGGAAGAAA
CTGGCCCAGGATGTCAGAGCCAAGGGCTACCTGGAGTGCTCAGCCCTTAGCAATCGGGGAGTACAGCAG
GTGTTTGAGTGCGCCGTCCGAACTGCCGTCAACCAGGCCAGGAGACGAAACAGAAGGAGGCTCTTCTCC
ATCAATGAGTGCAAGATCTTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278369
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278369.1
RefSeq Size 1872 bp
RefSeq ORF 576 bp
Locus ID 399
UniProt ID Q15669
Cytogenetics 4p14
Protein Families Transcription Factors
Protein Pathways Leukocyte transendothelial migration
MW 21.3 kDa
Gene Summary The protein encoded by this gene is a member of the Ras superfamily of guanosine triphosphate (GTP)-metabolizing enzymes. The encoded protein is expressed in hematopoietic cells, where it functions as a negative regulator of cell growth and survival. This gene may be hypermutated or misexpressed in leukemias and lymphomas. Chromosomal translocations in non-Hodgkin's lymphoma occur between this locus and B-cell CLL/lymphoma 6 (BCL6) on chromosome 3, leading to the production of fusion transcripts. Alternative splicing in the 5' untranslated region results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2013]
Transcript Variant: This variant (12) contains an alternate 5' exon and lacks two exons in the 5' UTR, compared to variant 1. Variants 1 through 12 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.