ZCCHC10 (NM_001300816) Human Untagged Clone

CAT#: SC334346

ZCCHC10 (untagged) - Human zinc finger, CCHC domain containing 10 (ZCCHC10), transcript variant 1


  "NM_001300816" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZCCHC10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZCCHC10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334346 representing NM_001300816.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGACTCCCATGCATCGGCTAATAGCCCGGAGACAAGCATTCGACACAGAGTTGCAGCCTGTCAAG
ACCTTTTGGATCCTGATTCAGCCATCCATCGTTATTAGTGAAGCAAATAAGCAACATGTAAGATGTCAG
AAATGCTTGGAATTTGGACATTGGACTTATGAATGCACAGGAAAAAGAAAATACCTACATAGGCCCTCA
AGGACAGCAGAACTAAAGAAAGCTTTAAAAGAAAAAGAAAACAGATTATTATTGCAACAAAGCATTGGA
GAAACCAATGTAGAAAGAAAGGCCAAGAAAAAAAGGTCTAAGAGTGTAACCAGTTCCAGTAGCAGTAGC
AGTGACAGTTCTGCCAGTGATTCTTCATCAGAGAGTGAAGAAACATCTACCTCTTCCTCCTCAGAGGAC
AGTGACACTGATGAAAGCTCCTCTAGTTCCTCATCCTCAGCCTCCTCCACAACCTCTTCCTCCTCCTCT
GATTCAGACTCAGATTCCAGCTCTTCCAGTAGCAGTAGCACCAGCACAGATAGCAGCTCTGACGATGAA
CCACCAAAGAAGAAGAAAAAGAAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001300816
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300816.2
RefSeq Size 2258 bp
RefSeq ORF 579 bp
Locus ID 54819
UniProt ID Q8TBK6
Cytogenetics 5q31.1
MW 21 kDa

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.