Endothelin 3 (EDN3) (NM_001302456) Human Untagged Clone

CAT#: SC334347

EDN3 (untagged) - Human endothelin 3 (EDN3), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EDN3
• Synonyms: ET-3; ET3; HSCR4; PPET3; WS4B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334347 representing NM_001302456.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGACCTCCGCCGCAGGATTCGTGCCTTGCTCC
  CAGTCTGGGGATGCTGGCAGGCGCGGCGTGTCCCAGGCCCCCACTGCAGCCAGATCTGAGGGGGACTGT
  GAAGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGCCCTGGCGAGGGGACTGTGGCCCCGACA
  GCACTGCAGGGTCCAAGCCCTGGAAGCCCTGGGCAGGAGCAGGCGGCCGAGGGGGCCCCTGAGCACCAC
  CGATCCAGGCGCTGCACGTGCTTCACCTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATC
  ATTTGGATCAACACTCCCGAACAGACGGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGC
  AAGAGGTCTGCGGGGCCACTTCCAGGGAATCTGCAGCTCTCACATCGGCCACACTTGCGCTGCGCTTGT
  GTGGGGAGATATGACAAGGCCTGCCTGCACTTTTGCACCCAAACTCTGGACGTCAGCAGGTTGAAGTCA
  AGGACCAACAAAGCAAGCAGGCTTTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001302456
• Insert Size: 579 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302456.1
• RefSeq Size: 2630 bp
• RefSeq ORF: 579 bp
• Locus ID: 1908
• UniProt ID: P14138
• Cytogenetics: 20q13.32
• Protein Families: Druggable Genome, Secreted Protein
• MW: 20.6 kDa
• Gene Summary: The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (6) lacks an exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 4. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1.