CSRP2 (NM_001300965) Human Untagged Clone

CAT#: SC334355

CSRP2 (untagged) - Human cysteine and glycine-rich protein 2 (CSRP2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSRP2
• Synonyms: CRP2; LMO5; SmLIM
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334355 representing NM_001300965.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCCTGTCTGGGGAGGTGGAAACAAGTGTGGGGCCTGTGGGAGGACCGTGTACCACGCAGAAGAGGTG
  CAGTGTGATGGCAGGAGCTTCCACCGCTGCTGCTTTCTCTGCATGGTTTGCAGGAAAAATTTAGATAGC
  ACAACAGTGGCAATTCACGATGAAGAGATCTACTGCAAATCCTGCTACGGAAAGAAGTATGGGCCAAAA
  GGCTACGGTTATGGCCAGGGCGCTGGCACGCTTAACATGGACCGTGGCGAGAGGCTGGGCATCAAACCA
  GAGAGTGTTCAGCCTCACAGGCCTACAACAAATCCAAACACTTCTAAATTTGCTCAGAAATATGGAGGT
  GCTGAGAAGTGTTCCAGATGTGGGGATTCTGTATATGCTGCCGAGAAGATAATTGGAGCTGGAAAGCCC
  TGGCACAAAAACTGTTTCCGATGTGCAAAGTGTGGGAAGAGTCTTGAATCAACAACTCTGACTGAAAAA
  GAAGGTGAAATCTATTGTAAAGGATGCTATGCAAAGAACTTTGGGCCCAAGGGATTTGGCTATGGCCAA
  GGAGCAGGGGCTCTTGTTCATGCCCAGTAA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300965
• Insert Size: 582 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300965.1
• RefSeq Size: 915 bp
• RefSeq ORF: 582 bp
• Locus ID: 1466
• UniProt ID: Q16527
• Cytogenetics: 12q21.2
• MW: 21 kDa
• Gene Summary: CSRP2 is a member of the CSRP family of genes, encoding a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. CRP2 contains two copies of the cysteine-rich amino acid sequence motif (LIM) with putative zinc-binding activity, and may be involved in regulating ordered cell growth. Other genes in the family include CSRP1 and CSRP3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.