SV2A (NM_001278719) Human Untagged Clone

CAT#: SC334363

SV2A (untagged) - Human synaptic vesicle glycoprotein 2A (SV2A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SV2A
• Synonyms: SV2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334363 representing NM_001278719.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACTGCCTGCTTATCTTGGCCTTTGCCCACAGACCTGTTCGAGTACAAGTTTGTGAACAGCCGTCTG
  ATAAACAGTACATTCCTGCACAACAAGGAGGGCTGCCCGCTAGACGTGACAGGGACGGGCGAAGGTGCC
  TACATGGTATACTTTGTGAGCTTCCTGGGGACACTGGCAGTGCTTCCTGGGAATATCGTGTCTGCCCTG
  CTCATGGACAAGATCGGCAGGCTCAGAATGCTTGCTGGCTCCAGCGTGATGTCCTGTGTCTCCTGCTTC
  TTCCTGTCTTTTGGGAACAGTGAGTCGGCCATGATCGCTCTGCTCTGCCTTTTTGGCGGGGTCAGCATT
  GCATCCTGGAATGCGCTGGACGTGTTGACTGTTGAACTCTACCCCTCAGACAAGAGGACCACAGCTTTT
  GGCTTCCTGAATGCCCTGTGTAAGCTGGCAGCTGTGCTGGGGATCAGCATCTTCACATCCTTCGTGGGA
  ATCACCAAGGCTGCACCCATCCTCTTTGCCTCAGCTGCCCTTGCCCTTGGCAGCTCTCTGGCCCTGAAG
  CTGCCTGAGACCCGGGGGCAGGTGCTGCAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278719
• Insert Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278719.1
• RefSeq Size: 2394 bp
• RefSeq ORF: 585 bp
• Locus ID: 9900
• UniProt ID: Q7L0J3
• Cytogenetics: 1q21.2
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: ECM-receptor interaction
• MW: 20.6 kDa
• Gene Summary: The protein encoded by this gene is one of three related synaptic vesicle proteins. The encoded protein may interact with synaptotagmin to enhance low frequency neurotransmission in quiescent neurons. [provided by RefSeq, Jun 2016]
  Transcript Variant: This variant (2) contains an alternate segment in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.