SEC13L1 (SEC13) (NM_001278946) Human Untagged Clone

CAT#: SC334366

SEC13 (untagged) - Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SEC13
• Synonyms: D3S1231E; npp-20; SEC13L1; SEC13R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334366 representing NM_001278946.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTGTCAGTAATTAACACTGTGGATACCTCCCATGAGGACATGATTCACGACGCCCAGATGGACTAC
  TATGGCACCCGCCTGGCAACCTGCTCATCAGACAGGTCCGTCAAAATCTTTGATGTGCGCAATGGAGGG
  CAGATCCTTATCGCCGACCTCAGGGGTCATGAGGGTCCTGTGTGGCAAGTGGCCTGGGCTCACCCCATG
  TACGGCAACATCCTGGCATCGTGCTCCTATGACCGGAAAGTCATTATCTGGAGAGAGGAAAACGGCACC
  TGGGAGAAGAGCCACGAGCATGCGGGACACGACTCCTCAGTGAACTCGGTGTGCTGGGCCCCCCATGAC
  TACGGCCTGATCCTGGCCTGTGGGAGCTCGGATGGGGCCATCTCCCTGCTGACTTACACCGGGGAAGGC
  CAATGGGAAGTAAAGAAGATCAACAACGCTCACACCGTGAGTCCATCCCCTGCCTTTCGTGCAGTGAGA
  GCGCCTGCCTTGCCCCGTGTCTGCTGCAGCCTCCCTAGAGGGTGGCACGGGAGGGTCCCCGCTGGACAG
  TGGGCCGGGGAGTGGTCAGCTGACCAGACATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278946
• Insert Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278946.1
• RefSeq Size: 985 bp
• RefSeq ORF: 585 bp
• Locus ID: 6396
• Cytogenetics: 3p25.3
• MW: 21.4 kDa
• Gene Summary: The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]
  Transcript Variant: This variant (5) differs in both UTRs and the 5' and 3' coding regions, compared to variant 3. It encodes isoform 5 which is shorter and has distinct N- and C-termini, compared to isoform 3.