Lysophospholipase 1 (LYPLA1) (NM_001279356) Human Untagged Clone

CAT#: SC334374

LYPLA1 (untagged) - Human lysophospholipase I (LYPLA1), transcript variant 2


  "NM_001279356" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-LYPLA1 antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "LYPLA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LYPLA1
Synonyms APT-1; APT1; hAPT1; LPL-I; LPL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334374 representing NM_001279356.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCCACCGCTGCG
GTGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCCTTTGCAGGTATCAGAAGT
TCACATATCAAATATATCTGCCCGCATGCGCCTGTTAGGCCTGTTACATTAAATATGAACGTGGCTATG
CCTTCATGGTTTGATATTATTGGGCTTTCACCAGATTCACAGGAGGATGAATCTGGGATTAAACAGGCA
GCAGAAAATATAAAAGCTTTGATTGATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTG
GGAGGGTTTTCTCAGGGTCCTATCGGTGGTGCTAATAGAGATATTTCTATTCTCCAGTGCCACGGGGAT
TGTGACCCTTTGGTTCCCCTGATGTTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCA
GCCAATGTGACCTTTAAAACCTATGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTC
AAGCAATTCATTGATAAACTCCTACCTCCAATTGATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001279356
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001279356.1
RefSeq Size 2494 bp
RefSeq ORF 591 bp
Locus ID 10434
UniProt ID O75608
Cytogenetics 8q11.23
Protein Pathways Glycerophospholipid metabolism
MW 21.1 kDa
Gene Summary This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.