Chimaerin 2 (CHN2) (NM_001293079) Human Untagged Clone

CAT#: SC334383

CHN2 (untagged) - Human chimerin 2 (CHN2), transcript variant 12

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHN2
• Synonyms: ARHGAP3; BCH; CHN2-3; RHOGAP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334383 representing NM_001293079.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTCTCTGAAGAACTGTGGCTGGAAAATGAGAAAAAGTGTGCTGTGGTTCGGAAGTCTAAGCAGGGC
  AGGAAACGCCAAGAACTGCTGGCCGTAGCCTTCGGGGTGAAGGTGGGTGTCAAAGGCGGCTTTCTTTGG
  CCCCCTCTCAAACTCTTTGCCTGTTCACAGATCTCCTCCCTGGTTCGAAGGGCTGCCCTCACACACAAC
  GACAACCACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACACTGGTGT
  GAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGACTGTGGATTGAAC
  GTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAACCTGATCTCAAGAGGATCAAGAAAGTG
  TACTGTTGTGACCTCACAACACTTGTGAAGGCTCACAACACTCAGAGACCCATGGTGGTAGACATATGC
  ATTCGGGAAATTGAAGCAAGAGGATTAAAATCGGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACAC
  ATTGAAGATGTCAAAATGGCATTTGACAGAGGGTTACTATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001293079
• Insert Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293079.1
• RefSeq Size: 2771 bp
• RefSeq ORF: 594 bp
• Locus ID: 1124
• UniProt ID: P52757
• Cytogenetics: 7p14.3
• MW: 22.6 kDa
• Gene Summary: This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (12, also known as B1-CHNdel ex11-12) lacks two alternate exons in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (12) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.