ALP (PDLIM3) (NM_001257963) Human Untagged Clone

CAT#: SC334384

PDLIM3 (untagged) - Human PDZ and LIM domain 3 (PDLIM3), transcript variant 4


  "NM_001257963" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-PDLIM3 Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PDLIM3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDLIM3
Synonyms ALP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334384 representing NM_001257963.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCCAGACGGTGATCCTCCCGGGCCCTGCGCCCTGGGGCTTCAGGCTCTCAGGGGGCATAGACTTC
AACCAGCCTTTGGTCATCACCAGGGACGGGAACTACTTTGAACACAAGCATAATATTCGGCCCAAACCT
TTCGTGATCCCGGGCCGAAGCAGCGAGCCCACAGCCTCGGTGCCCCCCGAGTCGGACGTGTACCGGATG
CTCCACGACAATCGGAATGAGCCCACACAGCCTCGCCAGTCGGGCTCCTTCAGAGTGCTCCAGGGAATG
GTGGACGATGGCTCTGATGACCGTCCGGCTGGAACGCGGAGTGTGAGAGCTCCGGTGACGAAAGTCCAT
GGCGGTTCAGGCGGGGCACAGAGGATGCCGCTCTGTGACAAATGTGGGAGTGGCATAGTCGGTGCTGTG
GTGAAGGCGCGGGATAAGTACCGGCACCCTGAGTGCTTCGTGTGTGCCGACTGCAACCTCAACCTCAAG
CAAAAGGGCTACTTCTTCATAGAAGGGGAGCTGTACTGCGAAACCCACGCAAGAGCCCGCACAAAGCCC
CCAGAGGGCTATGACACGGTCACTCTGTATCCCAAAGCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001257963
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257963.1
RefSeq Size 2352 bp
RefSeq ORF 594 bp
Locus ID 27295
Cytogenetics 4q35.1
MW 21.8 kDa
Gene Summary The protein encoded by this gene contains a PDZ domain and a LIM domain, indicating that it may be involved in cytoskeletal assembly. In support of this, the encoded protein has been shown to bind the spectrin-like repeats of alpha-actinin-2 and to colocalize with alpha-actinin-2 at the Z lines of skeletal muscle. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Aberrant alternative splicing of this gene may play a role in myotonic dystrophy. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (4) lacks three exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.