GGT6 (NM_001288703) Human Untagged Clone

CAT#: SC334393

GGT6 (untagged) - Human gamma-glutamyltransferase 6 (GGT6), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GGT6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334393 representing NM_001288703.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAGCGGGCAGAAGAGCCCGTGGTCTATCAGAAGCTGCTGCCCTGGGAGCCAAGCTTGGAGTCGGAG
  GAGGAAGTGGAGGAGGAGGAGACATCAGAGGCGCTGGTTCTAAACCCCCGGAGGCACCAGGACTCTTCC
  AGGAACAAGGCTGGCGGGCTGCCCGGAACCTGGGCCCGTGTAGTGGCAGCCCTGCTGCTGCTGGCTGTT
  GGCTGCTCCCTGGCTGTGAGGCAGCTCCAGAATCAGGGCAGGTCGACAGGAAGCTTGGGCTCTGTGGCC
  CCTCCACCCGGCGGACACTCCCACGGCCCTGGCGTATACCACCACGGTGCCATCATCAGCCCTGCAGGC
  CGAGAGCTGCTTGTTGCCGGGGGCAACGTCGTGGATGCTGGAGTTGGAGCTGCATTGTGCCTGGCAGTG
  GTGCATCCTCATGCCACGGGGCTAGACTGCTGTGAGCCCCGAGAGCAGTGCCCTGGCCGCCGTGGACAG
  CAGCGGCTCTGTGCTCCTTCTCACCTCCTCGCTCAACTGCTCCTTTGGCTCTGCACACCTGTCCCCAAG
  CACTGGGGTTCTGCTCAGCAACCTGGTGGCCAAGTCTACCACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001288703
• Insert Size: 597 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001288703.1
• RefSeq Size: 2062 bp
• RefSeq ORF: 597 bp
• Locus ID: 124975
• UniProt ID: Q6P531
• Cytogenetics: 17p13.2
• Protein Pathways: Arachidonic acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Metabolic pathways, Selenoamino acid metabolism, Taurine and hypotaurine metabolism
• MW: 21 kDa
• Gene Summary: GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]
  Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region and another alternate splice site in the 3' coding region, the latter resulting in a frameshift and an early stop codon, compared to variant 3. It encodes isoform d, which is shorter and has a distinct C-terminus, compared to isoform c.