TIPIN (NM_001289986) Human Untagged Clone

CAT#: SC334409

TIPIN (untagged) - Human TIMELESS interacting protein (TIPIN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TIPIN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334409 representing NM_001289986.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCTAATCAGACACATGGAGCACTGGGCACATAGGCTATTCCCTAAACTGCAGTTTGAGGATTTTATT
  GACAGAGTTGAATACCTGGGAAGTAAAAAGGAAGTTCAGACCTGTTTAAAACGAATTCGACTTGATCTC
  CCTATTTTACATGAAGATTTTGTTAGCAATAATGATGAAGTTGCGGAGAATAATGAACATGATGTCACT
  TCTACTGAATTAGATCCCTTTCTGACAAACTTATCTGAAAGTGAGATGTTTGCTTCTGAGTTAAGTAGA
  AGCCTAACAGAAGAGCAACAACAAAGAATTGAGAGAAATAAACAACTGGCCTTGGAAAGAAGGCAGGCA
  AAGCTGCTGAGTAATAGTCAGACCCTAGGAAATGATATGTTAATGAATACACCCAGGGCACACACGGTT
  GAAGAGGTTAATACTGATGAGGATCAAAAGGAGGAGTCAAATGGATTAAACGAAGACATTCTGGACAAT
  CCATGTAATGATGCTATTGCCAATACTTTAAATGAAGAGGAAACACTGCTGGACCAGTCTTTTAAAAAT
  GTGCAACAGCAACTTGATGCTACATCCAGAAATATTACTGAAGCTAGATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001289986
• Insert Size: 603 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289986.1
• RefSeq Size: 1219 bp
• RefSeq ORF: 603 bp
• Locus ID: 54962
• UniProt ID: Q9BVW5
• Cytogenetics: 15q22.31
• Protein Families: Druggable Genome
• MW: 23.3 kDa
• Gene Summary: The protein encoded by this gene is part of the replisome complex, a group of proteins that support DNA replication. It binds TIM, which is involved in circadian rhythm regulation, and aids in protecting cells against DNA damage and stress. Two pseudogenes and two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks an alternate exon compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (2) with a shorter N-terminus compared to isoform 1.