RANBP1 (NM_001278640) Human Untagged Clone

CAT#: SC334414

RANBP1 (untagged) - Human RAN binding protein 1 (RANBP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RANBP1
• Synonyms: HTF9A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334414 representing NM_001278640.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCCGCCAAGGACACTCATGAGGACCATGATACTTCCACTGAGAATACAGACGAGTCCAACCAT
  GACCCTCAGTTTGAGCCAATAGTTTCTCTTCCTGAGCAAGAAATTAAAACACTGGAAGAAGATGAAGAG
  GAACTTTTTAAAATGCGGGCAAAACTGTTCCGATTTGCCTCTGAGAACGATCTCCCAGAATGGAAGGAG
  CGAGGCACTGGTGACGTCAAGCTCCTGAAGCACAAGGAGAAAGGGGCCATCCGCCTCCTCATGCGGAGG
  GACAAGACCCTGAAGATCTGTGCCAACCACTACATCACGCCGATGATGGAGCTGAAGCCCAACGCAGGT
  AGCGACCGTGCCTGGGTCTGGAACACCCACGCTGACTTCGCCGACGAGTGCCCCAAGCCAGAGCTGCTG
  GCCATCCGCTTCCTGAATGCTGAGAATGCACAGAAATTCAAAACAAAGTTTGAAGAATGCAGGAAAGAG
  ATCGAAGAGAGAGAAAAGAAAGGATCAGGCAAAAATGATCATGCCGAAAAAGTGGCGGAAAAGCTAGAA
  GCTCTCTCGGTGAAGGAGGAGACCAAGGAGGATGCTGAGGAGAAGCAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278640
• Insert Size: 603 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278640.1
• RefSeq Size: 1134 bp
• RefSeq ORF: 603 bp
• Locus ID: 5902
• UniProt ID: P43487
• Cytogenetics: 22q11.21
• MW: 23.2 kDa
• Gene Summary: This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (3) contains multiple differences, compared to variant 1. It initiates translation at an alternate start codon. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1.