Rab5 (RAB5A) (NM_001292048) Human Untagged Clone

CAT#: SC334416

RAB5A (untagged) - Human RAB5A, member RAS oncogene family (RAB5A), transcript variant 2


  "NM_001292048" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00


RAB5A mouse monoclonal antibody,clone OTI6D9
    • 100 ul

USD 447.00

Other products for "RAB5A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB5A
Synonyms RAB5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334416 representing NM_001292048.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTAGTCGAGGCGCAACAAGACCCAACGGGCCAAATACGGGAAATAAAATATGCCAGTTCAAACTA
GTACTTCTGGGAGAGTCCGCTGTTGGCAAATCAAGCCTAGTGCTTCGTTTTGTGAAAGGCCAATTTCAT
GAATTTCAAGAGAGTACCATTGGGGTAAAGTTTGAAATATGGGATACAGCTGGTCAAGAACGATACCAT
AGCCTAGCACCAATGTACTACAGAGGAGCACAAGCAGCCATAGTTGTATATGATATCACAAATGAGGAG
TCCTTTGCAAGAGCAAAAAATTGGGTTAAAGAACTTCAGAGGCAAGCAAGTCCTAACATTGTAATAGCT
TTATCGGGAAACAAGGCCGACCTAGCAAATAAAAGAGCAGTAGATTTCCAGGAAGCACAGTCCTATGCA
GATGACAATAGTTTATTATTCATGGAGACATCCGCTAAAACATCAATGAATGTAAATGAAATATTCATG
GCAATAGCTAAAAAATTGCCAAAGAATGAACCACAAAATCCAGGAGCAAATTCTGCCAGAGGAAGAGGA
GTAGACCTTACCGAACCCACACAACCAACCAGGAATCAGTGTTGTAGTAACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001292048
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001292048.1
RefSeq Size 2506 bp
RefSeq ORF 606 bp
Locus ID 5868
UniProt ID P20339
Cytogenetics 3p24.3
Protein Families Druggable Genome
Protein Pathways Amyotrophic lateral sclerosis (ALS), Endocytosis
MW 22.2 kDa
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB5A is required for the fusion of plasma membranes and early endosomes (PubMed:10818110, PubMed:14617813, PubMed:16410077, PubMed:15378032). Contributes to the regulation of filopodia extension (PubMed:14978216). Required for the exosomal release of SDCBP, CD63, PDCD6IP and syndecan (PubMed:22660413). Regulates maturation of apoptotic cell-containing phagosomes, probably downstream of DYN2 and PIK3C3 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.