Rab5 (RAB5A) (NM_001292048) Human Untagged Clone

CAT#: SC334416

RAB5A (untagged) - Human RAB5A, member RAS oncogene family (RAB5A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB5A
• Synonyms: RAB5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334416 representing NM_001292048.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTAGTCGAGGCGCAACAAGACCCAACGGGCCAAATACGGGAAATAAAATATGCCAGTTCAAACTA
  GTACTTCTGGGAGAGTCCGCTGTTGGCAAATCAAGCCTAGTGCTTCGTTTTGTGAAAGGCCAATTTCAT
  GAATTTCAAGAGAGTACCATTGGGGTAAAGTTTGAAATATGGGATACAGCTGGTCAAGAACGATACCAT
  AGCCTAGCACCAATGTACTACAGAGGAGCACAAGCAGCCATAGTTGTATATGATATCACAAATGAGGAG
  TCCTTTGCAAGAGCAAAAAATTGGGTTAAAGAACTTCAGAGGCAAGCAAGTCCTAACATTGTAATAGCT
  TTATCGGGAAACAAGGCCGACCTAGCAAATAAAAGAGCAGTAGATTTCCAGGAAGCACAGTCCTATGCA
  GATGACAATAGTTTATTATTCATGGAGACATCCGCTAAAACATCAATGAATGTAAATGAAATATTCATG
  GCAATAGCTAAAAAATTGCCAAAGAATGAACCACAAAATCCAGGAGCAAATTCTGCCAGAGGAAGAGGA
  GTAGACCTTACCGAACCCACACAACCAACCAGGAATCAGTGTTGTAGTAACTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001292048
• Insert Size: 606 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001292048.1
• RefSeq Size: 2506 bp
• RefSeq ORF: 606 bp
• Locus ID: 5868
• UniProt ID: P20339
• Cytogenetics: 3p24.3
• Protein Families: Druggable Genome
• Protein Pathways: Amyotrophic lateral sclerosis (ALS), Endocytosis
• MW: 22.2 kDa
• Gene Summary: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB5A is required for the fusion of plasma membranes and early endosomes (PubMed:10818110, PubMed:14617813, PubMed:16410077, PubMed:15378032). Contributes to the regulation of filopodia extension (PubMed:14978216). Required for the exosomal release of SDCBP, CD63, PDCD6IP and syndecan (PubMed:22660413). Regulates maturation of apoptotic cell-containing phagosomes, probably downstream of DYN2 and PIK3C3 (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice site in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1.