SSH2 (NM_001282131) Human Untagged Clone

CAT#: SC334424

SSH2 (untagged) - Human slingshot protein phosphatase 2 (SSH2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SSH2
• Synonyms: SSH-2; SSH-2L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334424 representing NM_001282131.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACCCTGAGCACGTTGGCCCGCAAGAGGAAGGCGCCCCTCGCTTGCACCTGCAGCCTCGGTGGCCCC
  GACATGATTCCTTACTTCTCCGCCAACGCGGTCATCTCGCAGAACGCCATCAACCAGCTCATCAGCGAG
  AGCTTTCTAACTGTCAAAGGTGCTGCCCTTTTTCTACCACGGGGAAATGGCTCATCCACACCAAGAATC
  AGCCACAGACGGAACAAGCATGCAGGCGATCTCCAACAGCATCTCCAAGCAATGTTCATTTTACTCCGC
  CCAGAAGACAACATCAGGCTGGCTGTAAGACTGGAAAGTACTTACCAGAATCGAACACGCTATATGGTA
  GTGGTTTCAACTAATGGTAGACAAGACACTGAAGAAAGCATCGTCCTAGGAATGGATTTCTCCTCTAAT
  GACAGTAGCACTTGTACCATGGGCTTAGTTTTGCCTCTCTGGAGCGACACGCTAATTCATTTGGATGGT
  GATGGTGGGTTCAGTGTATCGACGGATAACAGAGTTCACATATTCAAACCTGTATCTGTGCAGGCAATG
  TGGGTTGACAGGGATTCAAGGAACAAACACTGTGATGTACTATTGGTGGAAGAATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282131
• Insert Size: 609 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282131.1
• RefSeq Size: 972 bp
• RefSeq ORF: 609 bp
• Locus ID: 85464
• UniProt ID: Q76I76
• Cytogenetics: 17q11.2
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: Regulation of actin cytoskeleton
• MW: 22.4 kDa
• Gene Summary: This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (4) contains multiple differences in the UTRs and coding region, compared to variant 1, including the lack of multiple 5' and 3' coding exons. It represents use of an internal promoter and initiates translation at an alternate start codon. The encoded isoform (4) is shorter and has distinct N- and C- termini, compared to isoform 1.