TRIB1 (NM_001282985) Human Untagged Clone

CAT#: SC334452

TRIB1 (untagged) - Human tribbles pseudokinase 1 (TRIB1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRIB1
• Synonyms: C8FW; GIG-2; GIG2; SKIP1; TRB-1; TRB1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334452 representing NM_001282985.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCACTCCTATGTGCGAAGCCGGAAGAGGCTGCGGGAAGAGGAAGCCGCCCGGCTCTTCAAGCAGATT
  GTCTCCGCCGTCGCCCACTGCCACCAGTCAGCCATCGTGCTGGGGGACCTGAAGCTTAGGAAGTTCGTC
  TTCTCCACGGAGGAGAGAACCCAGCTTAGACTAGAAAGTCTAGAAGACACACACATAATGAAGGGGGAA
  GATGATGCTTTGTCAGACAAACATGGCTGCCCAGCCTACGTGAGCCCTGAGATCCTCAACACCACTGGG
  ACCTACTCCGGAAAGGCTGCGGACGTTTGGAGCCTGGGGGTGATGCTCTACACCCTTCTGGTTGGACGA
  TACCCCTTCCATGACTCAGACCCCAGTGCCCTTTTCTCCAAAATTCGGCGTGGACAGTTCTGCATTCCT
  GAGCACATTTCCCCCAAAGCCAGGTGCCTCATTCGCAGCCTCTTGAGACGGGAGCCCTCCGAGAGACTC
  ACTGCCCCCGAGATCCTACTGCACCCCTGGTTTGAGTCCGTCTTGGAACCCGGGTACATCGACTCAGAA
  ATAGGAACTTCAGACCAGATTGTTCCAGAGTACCAGGAGGACAGTGACATTAGTTCCTTCTTCTGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282985
• Insert Size: 621 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282985.1
• RefSeq Size: 2823 bp
• RefSeq ORF: 621 bp
• Locus ID: 10221
• UniProt ID: Q96RU8
• Cytogenetics: 8q24.13
• Protein Families: Druggable Genome, Protein Kinase
• MW: 23.5 kDa
• Gene Summary: Adapter protein involved in protein degradation by interacting with COP1 ubiquitin ligase (PubMed:27041596). The COP1-binding motif is masked by autoinhibitory interactions with the protein kinase domain (PubMed:26455797). Serves to alter COP1 substrate specificity by directing the activity of COP1 toward CEBPA (PubMed:27041596). Binds selectively the recognition sequence of CEBPA (PubMed:26455797). Regulates myeloid cell differentiation by altering the expression of CEBPA in a COP1-dependent manner (By similarity). Controls macrophage, eosinophil and neutrophil differentiation via the COP1-binding domain (By similarity). Interacts with MAPK kinases and regulates activation of MAP kinases, but has no kinase activity (PubMed:15299019, PubMed:26455797).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.