E2F6 (NM_001278277) Human Untagged Clone

CAT#: SC334454

E2F6 (untagged) - Human E2F transcription factor 6 (E2F6), transcript variant d

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: E2F6
• Synonyms: E2F-6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334454 representing NM_001278277.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATCTTGTCAGATCTGCTCCCGGGGGTATTCTTGACTTAAACAAGGTTGCAACGAAACTGGGAGTC
  CGAAAGCGGAGAGTGTATGACATCACCAATGTCTTAGATGGAATCGACCTCGTTGAAAAGAAATCCAAG
  AACCATATTAGATGGATAGGATCTGATCTTAGCAATTTTGGAGCAGTTCCCCAACAAAAGAAGCTACAG
  GAGGAACTTTCTGACTTATCAGCAATGGAAGATGCTTTGGATGAGTTAATTAAGGATTGTGCTCAGCAG
  CTGTTTGAGTTAACAGATGACAAAGAAAATGAAAGACTAGCATATGTGACCTATCAAGACATTCATAGC
  ATTCAGGCCTTCCATGAACAGATCGTCATTGCAGTTAAAGCTCCAGCAGAAACCAGATTGGATGTTCCA
  GCTCCCAGAGAAGACTCTATCACAGTGCACATAAGGAGCACCAACGGACCTATCGATGTCTATTTGTGT
  GAAGTGGAGCAGGGTCAGACCAGTAACAAAAGGTCTGAAGGTGTCGGGACCTCTTCATCTGAGAGCACT
  CATCCAGAAGGCCCTGAGGAAGAAGAAAATCCTCAGCAAAGTGAAGAATTGCTTGAAGTAAGCAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278277
• Insert Size: 621 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278277.1
• RefSeq Size: 3450 bp
• RefSeq ORF: 621 bp
• Locus ID: 1876
• UniProt ID: O75461
• Cytogenetics: 2p25.1
• Protein Families: Transcription Factors
• MW: 23 kDa
• Gene Summary: This gene encodes a member of a family of transcription factors that play a crucial role in the control of the cell cycle. The protein encoded by this gene lacks the transactivation and tumor suppressor protein association domains found in other family members, and contains a modular suppression domain that functions in the inhibition of transcription. It interacts in a complex with chromatin modifying factors. There are pseudogenes for this gene on chromosomes 22 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (d) contains two alternate exons and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants c, d, and e encode the same isoform (3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.