E2F6 (NM_001278278) Human Untagged Clone

CAT#: SC334455

E2F6 (untagged) - Human E2F transcription factor 6 (E2F6), transcript variant e


  "NM_001278278" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-E2F6 antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "E2F6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol E2F6
Synonyms E2F-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334455 representing NM_001278278.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATCTTGTCAGATCTGCTCCCGGGGGTATTCTTGACTTAAACAAGGTTGCAACGAAACTGGGAGTC
CGAAAGCGGAGAGTGTATGACATCACCAATGTCTTAGATGGAATCGACCTCGTTGAAAAGAAATCCAAG
AACCATATTAGATGGATAGGATCTGATCTTAGCAATTTTGGAGCAGTTCCCCAACAAAAGAAGCTACAG
GAGGAACTTTCTGACTTATCAGCAATGGAAGATGCTTTGGATGAGTTAATTAAGGATTGTGCTCAGCAG
CTGTTTGAGTTAACAGATGACAAAGAAAATGAAAGACTAGCATATGTGACCTATCAAGACATTCATAGC
ATTCAGGCCTTCCATGAACAGATCGTCATTGCAGTTAAAGCTCCAGCAGAAACCAGATTGGATGTTCCA
GCTCCCAGAGAAGACTCTATCACAGTGCACATAAGGAGCACCAACGGACCTATCGATGTCTATTTGTGT
GAAGTGGAGCAGGGTCAGACCAGTAACAAAAGGTCTGAAGGTGTCGGGACCTCTTCATCTGAGAGCACT
CATCCAGAAGGCCCTGAGGAAGAAGAAAATCCTCAGCAAAGTGAAGAATTGCTTGAAGTAAGCAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278278
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278278.1
RefSeq Size 3191 bp
RefSeq ORF 621 bp
Locus ID 1876
UniProt ID O75461
Cytogenetics 2p25.1
Protein Families Transcription Factors
MW 23 kDa
Gene Summary This gene encodes a member of a family of transcription factors that play a crucial role in the control of the cell cycle. The protein encoded by this gene lacks the transactivation and tumor suppressor protein association domains found in other family members, and contains a modular suppression domain that functions in the inhibition of transcription. It interacts in a complex with chromatin modifying factors. There are pseudogenes for this gene on chromosomes 22 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (e) lacks an alternate exon in the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants c, d, and e encode the same isoform (3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.