IPP 2 (PPP1R2) (NM_001291504) Human Untagged Clone

CAT#: SC334456

PPP1R2 (untagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), transcript variant 1


  "NM_001291504" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal PPP1R2 (Ab-120/121) antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PPP1R2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP1R2
Synonyms IPP-2; IPP2; PPP1R2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334456 representing NM_001291504.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCTCGACGGCCTCGCACCGGCCCATCAAGGGGATCTTGAAGAACAAGACCTCTACGACTTCC
TCTATGGTGGCGTCGGCCGAACAGCCCCGCGGGAATGTCGACGAGGAGCTGAGCAAAAAATCCCAGAAG
TGGGATGAAATGAACATCTTGGCGACGTATCATCCAGCAGACAAAGACTATGGTTTAATGAAAATAGAT
GAACCAAGCACTCCTTACCATAGTATGATGGGGGATGATGAAGATGCCTGTAGTGACACCGAGGCCACT
GAAGCCATGGCGCCAGACATCTTAGCCAGGAAATTAGCTGCAGCTGAAGGCTTGGAGCCAAAGTATCGG
ATTCAGGAACAAGAAAGCAGTGGAGAGGAGGATAGTGACCTCTCACCTGAAGAACGAGGTAAAAAAAAG
CGACAATTTGAAATGAAAAGGAAGCTTCACTACAATGAAGGACTCAATATCAAACTAGCCAGACAATTA
ATTTCAAAAGACCTACATGATGATGATGAAGATGAAGAAATGTTAGAGACTGCAGATGGAGAAAGCATG
AATACGGAAGAATCAAATCAAGGATCTACTCCAAGTGACCAACAGCAAAACAAATTACGAAGTTCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001291504
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291504.1
RefSeq Size 3471 bp
RefSeq ORF 621 bp
Locus ID 5504
Cytogenetics 3q29
Protein Families Druggable Genome
MW 23.1 kDa
Gene Summary Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.