Cyclin Y (CCNY) (NM_001282854) Human Untagged Clone

CAT#: SC334478

CCNY (untagged) - Human cyclin Y (CCNY), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCNY
• Synonyms: C10orf9; CBCP1; CCNX; CFP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334478 representing NM_001282854.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGACCCAGATGGAAGGATGCTCTTAGATATTTTTGATGAAAATCTTCACCCTCTTTCGAAATCCGAA
  GTGCCACCAGATTATGACAAACACAACCCAGAGCAGAAGCAGATTTACCGGTTCGTTCGGACACTGTTC
  AGTGCTGCTCAGCTGACGGCTGAATGTGCCATCGTCACCCTGGTGTACCTTGAAAGACTTTTAACATAC
  GCAGAGATAGATATCTGTCCGGCCAACTGGAAGCGGATTGTTTTAGGGGCGATCCTGCTGGCCTCCAAG
  GTGTGGGATGACCAGGCTGTATGGAATGTGGATTACTGCCAGATCCTGAAAGACATCACGGTGGAGGAC
  ATGAACGAGCTAGAGCGACAGTTTCTTGAATTGCTGCAGTTCAACATCAATGTTCCTTCCAGTGTCTAT
  GCCAAGTATTATTTTGATCTTCGTTCTCTGGCAGAAGCGAACAACCTGAGCTTTCCCTTGGAGCCCCTG
  AGCAGGGAGAGGGCTCACAAGCTTGAGGCCATCTCTCGCCTCTGCGAGGACAAGTACAAGGACCTAAGA
  AGATCCGCGAGGAAGCGCTCAGCCAGTGCAGACAACCTGACTCTGCCCCGGTGGTCCCCAGCCATCATC
  TCTTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282854
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282854.1
• RefSeq Size: 4574 bp
• RefSeq ORF: 627 bp
• Locus ID: 219771
• UniProt ID: Q8ND76
• Cytogenetics: 10p11.21
• MW: 24.2 kDa
• Gene Summary: Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]).[supplied by OMIM, May 2009]
  Transcript Variant: This variant (5) lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (5) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.