SRA1 (NM_001253764) Human Untagged Clone

CAT#: SC334479

SRA1 (untagged) - Human steroid receptor RNA activator 1 (SRA1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRA1
• Synonyms: pp7684; SRA; SRAP; STRAA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334479 representing NM_001253764.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGAGCTGTACGTGAAGCCGGGTGAGCGCAGCCGGCGGGCTAGGGCACTAGGTTGTCGCCCCGGC
  CTAGGCTGGGGGCGGTTGCGGCGCTTAGTATGGACCCTCTGTCTCCCCCAGCCCCAGTATAAGCTAACA
  GTGGAGTTCCGGGCTCGCTTCACACATCCCTCGCCTCCGCAGGCAACAAGGAACGCGGCTGGAACGACC
  CGCCGCAGTTCTCATACGGGCTGCAGACCCAGGCCGGCGGACCCAGGCGCTCGCTGCTTACCAAGAGGG
  TCGCCGCACCCCAGGATGGATCCCCCAGAGAAGCAGGTATGTGATGACATCAGCCGACGCCTGGCACTG
  CTGCAGGAACAGTGGGCTGGAGGAAAGTTGTCAATACCTGTAAAGAAGAGAATGGCTCTACTGGTGCAA
  GAGCTTTCAAGCCACCGGTGGGACGCAGCAGATGACATCCACCGCTCCCTCATGGTTGACCATGTGACT
  GAGGTCAGTCAGTGGATGGTAGGAGTTAAAAGATTAATTGCAGAAAAGAGGAGTCTGTTTTCAGAGGAG
  GCAGCCAATGAAGAGAAATCTGCAGCCACAGCTGAGAAGAACCATACCATACCAGGCTTCCAGCAGGCT
  TCATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001253764
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253764.1
• RefSeq Size: 1270 bp
• RefSeq ORF: 627 bp
• Locus ID: 10011
• Cytogenetics: 5q31.3
• MW: 23.4 kDa
• Gene Summary: Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
  Transcript Variant: This variant (2) retains a segment in the 5' coding region and lacks a downstream coding exon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct segment in the N-terminal region, compared to isoform 1.