TNFAIP8 (NM_001286814) Human Untagged Clone

CAT#: SC334487

TNFAIP8 (untagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFAIP8
• Synonyms: GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334487 representing NM_001286814.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACTCTACCAAGATACTGTGAAGTTGTCCTTCTGATTGCACACGGGGAGAAAATGCTGAAACTAGTG
  GCCACAGATGTCTTTAATTCCAAAAACCTGGCCGTTCAGGCACAAAAGAAGATCTTGGGTAAAATGGTG
  TCCAAATCCATCGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACAGAGTG
  ACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGTCATC
  AAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTTAAG
  AAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGGAAT
  GTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACTGCC
  AAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCCTTGTAT
  AATCCTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGATGGTATCAACAAAATGTTGGATGAA
  GAGAACATATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286814
• Insert Size: 633 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286814.1
• RefSeq Size: 2258 bp
• RefSeq ORF: 633 bp
• Locus ID: 25816
• UniProt ID: O95379
• Cytogenetics: 5q23.1
• Protein Families: Druggable Genome
• MW: 24.4 kDa
• Gene Summary: Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) contains an alternate 5'-terminal exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) has a longer and distinct N-terminus, compared to isoform a.