ST2 (IL1RL1) (NM_001282408) Human Untagged Clone

CAT#: SC334489

IL1RL1 (untagged) - Human interleukin 1 receptor-like 1 (IL1RL1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL1RL1
• Synonyms: DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334489 representing NM_001282408.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTATTCAACAGTATCTGGATCAGAAAAAAATTCCAAAATTTATTGTCCTACCATTGACCTCTACAAC
  TGGACAGCACCTCTTGAGTGGTTTAAGAATTGTCAGGCTCTTCAAGGATCAAGGTACAGGGCGCACAAG
  TCATTTTTGGTCATTGATAATGTGATGACTGAGGACGCAGGTGATTACACCTGTAAATTTATACACAAT
  GAAAATGGAGCCAATTATAGTGTGACGGCGACCAGGTCCTTCACGGTCAAGGATGAGCAAGGCTTTTCT
  CTGTTTCCAGTAATCGGAGCCCCTGCACAAAATGAAATAAAGGAAGTGGAAATTGGAAAAAACGCAAAC
  CTAACTTGCTCTGCTTGTTTTGGAAAAGGCACTCAGTTCTTGGCTGCCGTCCTGTGGCAGCTTAATGGA
  ACAAAAATTACAGACTTTGGTGAACCAAGAATTCAACAAGAGGAAGGGCAAAATCAAAGTTTCAGCAAT
  GGGCTGGCTTGTCTAGACATGGTTTTAAGAATAGCTGACGTGAAGGAAGAGGATTTATTGCTGCAGTAC
  GACTGTCTGGCCCTGAATTTGCATGGCTTGAGAAGGCACACCGTAAGACTAAGTAGGAAAAATCCAAGT
  AAGGAGTGTTTCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282408
• Insert Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282408.1
• RefSeq Size: 3589 bp
• RefSeq ORF: 636 bp
• Locus ID: 9173
• UniProt ID: Q01638
• Cytogenetics: 2q12.1
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• MW: 23.7 kDa
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) has multiple differences, compared to variant 1. These differences result in distinct 5' and 3' UTRs, cause translation initiation at a downstream start codon and translation termination at a different stop codon, compared to variant 1. It encodes isoform 3 which has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform 1.