FAM177A1 (NM_001289022) Human Untagged Clone

CAT#: SC334502

FAM177A1 (untagged) - Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 3


  "NM_001289022" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAM177A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FAM177A1
Synonyms C14orf24
Vector pCMV6-Entry
Sequence Data
>SC334502 representing NM_001289022.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCAGGAGCCAGTGGGCGGTGTGGAACGAGGAGAAGCCGTCGCAGCCTCGGGAGCTGCGGCCGCC
GCGGCATTCGGGGAATCTGCAGGGCAGATGAGTAACGAAAGAGGCTTTGAAAATGTAGAACTGGGAGTC
ATAGGAAAAAAGAAGAAAGTCCCAAGGAGAGTCATCCACTTTGTTAGTGGTGAAACAATGGAAGAATAT
AGCACAGATGAAGACGAAGTTGATGGCCTGGAGAAGAAAGATGTTTTGCCTACTGTTGATCCGACAAAA
CTTACCTGGGGTCCCTACTTATGGTTTTACATGCTTCGGGCTGCTACATCAACTCTCTCAGTGTGTGAC
TTCCTTGGAGAGAAGATTGCATCTGTTTTGGGTATCAGCACCCCAAAGTACCAATATGCCATTGATGAA
TATTATCGGATGAAGAAGGAGGAAGAAGAAGAAGAAGAAGAAAACAGGATGTCTGAAGAAGCAGAAAAA
CAATATCAACAGAATAAATTGCAGACTGATTCCATTGTTCAGACAGATCAACCAGAGACAGTGATATCC
AGCTCATTTGTGAATGTCAATTTTGAAATGGAGGGAGACAGTGAAGTAATTATGGAAAGCAAGCAAAAT
CCAGTCTCTGTCCCACCATAA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001289022
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289022.1
RefSeq Size 2999 bp
RefSeq ORF 642 bp
Locus ID 283635
UniProt ID Q8N128
Cytogenetics 14q13.2
MW 23.8 kDa
Gene Summary This gene encodes a member of a conserved protein family. Alternative splicing results in multiple transcript variants. This gene is thought to be associated with susceptibility to juvenile idiopathic arthritis. [provided by RefSeq, Apr 2017]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform 2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.