Proteasome 20S beta 6 (PSMB6) (NM_001270481) Human Untagged Clone

CAT#: SC334506

PSMB6 (untagged) - Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSMB6
• Synonyms: DELTA; LMPY; Y
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334506 representing NM_001270481.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGGGGGCCGGAGGCGTTCACT
  CCAGACTGGGAAAGCCGAGAAGTTTCCACTGGGACCACTATCATGGCCGTGCAGTTTGACGGGGGCGTG
  GTTCTGGGGGCGGACTCCAGAACAACCACTGGGTCCTACATCGCCAATCGAGTGACTGACAAGCTGACA
  CCTATTCACGACCGCATTTTCTGCTGTCGCTCAGGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCT
  GTCACCTACCAGCTCGGTTTCCACAGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCCAGC
  CTCTTTAAGGAGATGTGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATCGCAGGCTGGGAC
  CCTCAAGAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATGGTAAGGCAGTCCTTTGCCATT
  GGAGGCTCCGGGAGCTCCTACATCTATGGCTATGTTGATGCTACCTACCGGGAAGGCATGACCAAGGAA
  GAGTGTCTGCAATTCACTGCCAATGCTTTCTTCTTTTATCCACAGCTCTCGCTTTGGCCATGGAGCGGG
  ATGGCTCCAGTGGAGGAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001270481
• Insert Size: 642 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270481.1
• RefSeq Size: 889 bp
• RefSeq ORF: 642 bp
• Locus ID: 5694
• Cytogenetics: 17p13.2
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Proteasome
• MW: 23.1 kDa
• Gene Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. It is not known whether this isoform (2) is proteolytically processed in the same manner as isoform 1.