SSX2 (NM_001278697) Human Untagged Clone

CAT#: SC334515

SSX2 (untagged) - Human synovial sarcoma, X breakpoint 2 (SSX2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SSX2
• Synonyms: CT5.2; CT5.2A; HD21; HOM-MEL-40; SSX
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334515 representing NM_001278697.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAACGGAGACGACGCCTTTGCAAGGAGACCCACGGTTGGTGCTCAAATACCAGAGAAGATCCAAAAG
  GCCTTCGATGATATTGCCAAATACTTCTCTAAGGAAGAGTGGGAAAAGATGAAAGCCTCGGAGAAAATC
  TTCTATGTGTATATGAAGAGAAAGTATGAGGCTATGACTAAACTAGGTTTCAAGGCCACCCTCCCACCT
  TTCATGTGTAATAAACGGGCCGAAGACTTCCAGGGGAATGATTTGGATAATGACCCTAACCGTGGGAAT
  CAGGTTGAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTCCCCGAAGATCATGCCCAAGAAG
  CCAGCAGAGGAAGGAAATGATTCGGAGGAAGTGCCAGAAGCATCTGGCCCACAAAATGATGGGAAAGAG
  CTGTGCCCCCCGGGAAAACCAACTACCTCTGAGAAGATTCACGAGAGATCTGGAAATAGGGAGGCCCAA
  GAAAAGGAAGAGAGACGCGGAACAGCTCATCGGTGGAGCAGTCAGAACACACACAACATTGGACCCAAA
  AGGGGGGAACATGCCTGGACCCACAGACTGCGTGAGAGAAAACAGCTGGTGATTTATGAAGAGATCAGC
  GACCCTGAGGAAGATGACGAGTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278697
• Insert Size: 645 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278697.1
• RefSeq Size: 1426 bp
• RefSeq ORF: 645 bp
• Locus ID: 6757
• UniProt ID: Q16385
• Cytogenetics: Xp11.22
• Protein Families: Druggable Genome, Transcription Factors
• MW: 24.7 kDa
• Gene Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. This gene, and also the SSX1 and SSX4 family members, have been involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. This gene also has an identical duplicate, GeneID: 727837, located about 45 kb downstream in the opposite orientation on chromosome X. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (3) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (c) contains a shorter and distinct C-terminus, compared to isoform a.