FUSIP1 (SRSF10) (NM_001300937) Human Untagged Clone

CAT#: SC334546

SRSF10 (untagged) - Human serine/arginine-rich splicing factor 10 (SRSF10), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRSF10
• Synonyms: FUSIP1; FUSIP2; NSSR; PPP1R149; SFRS13; SFRS13A; SRp38; SRrp40; TASR; TASR1; TASR2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334546 representing NM_001300937.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCCCGCTACCTGCGTCCCCCCAACACGTCTCTGTTCGTCAGGAACGTGGCCGACGACACCAGGTCT
  GAAGACTTGCGGCGTGAATTTGGTCGTTATGGTCCTATAGTTGATGTGTATGTTCCACTTGATTTCTAC
  ACTCGCCGTCCAAGAGGATTTGCTTATGTTCAATTTGAGGATGTTCGTGATGCTGAAGACGCTTTACAT
  AATTTGGACAGAAAGTGGATTTGTGGACGGCAGATTGAAATACAGTTTGCCCAGGGGGATCGAAAGACA
  CCAAATCAGATGAAAGCCAAGGAAGGGAGGAATGTGTACAGTTCTTCACGCTATGATGATTATGACAGA
  TACAGACGTTCTAGAAGCCGAAGTTATGAAAGGAGGAGATCAAGAAGTCGGTCTTTTGATTACAACTAT
  AGAAGATCGTATAGTCCTAGAAACAGTAGACCGACTGGAAGACCACGGCGTAGCAGAAGCCATTCCGAC
  AATGATAGATTCAAACACCGAAATCGATCTTTTTCAAGATCTAAATCCAATTCAAGATCACGGTCCAAG
  TCCCAGCCCAAGAAAGAAATGAAGGCTAAATCACGTTCTAGACCAAACTGCAGCTGGAATACCCAGTAC
  AGTTCTGCTTACTACACTTCAAGAAAGATCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300937
• Insert Size: 654 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300937.1
• RefSeq Size: 4178 bp
• RefSeq ORF: 654 bp
• Locus ID: 10772
• Cytogenetics: 1p36.11
• Protein Families: Transcription Factors
• Protein Pathways: Spliceosome
• MW: 26.3 kDa
• Gene Summary: This gene product is a member of the serine-arginine (SR) family of proteins, which are involved in constitutive and regulated RNA splicing. Members of this family are characterized by N-terminal RNP1 and RNP2 motifs, which are required for binding to RNA, and multiple C-terminal SR/RS repeats, which are important in mediating association with other cellular proteins. This protein interacts with the oncoprotein TLS, and abrogates the influence of TLS on adenovirus E1A pre-mRNA splicing. This gene has pseudogenes on chromosomes 4, 9, 14, 18, and 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (9) lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (9) has a distinct C-terminus and is shorter than isoform 2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.