VAP1 (AOC3) (NM_001277732) Human Untagged Clone

CAT#: SC334559

AOC3 (untagged) - Human amine oxidase, copper containing 3 (AOC3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AOC3
• Synonyms: HPAO; SSAO; VAP-1; VAP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334559 representing NM_001277732.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGG
  AAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTG
  GCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGA
  GAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACC
  CAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTG
  GATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGT
  TTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTC
  CTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGG
  GACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCC
  GACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001277732
• Insert Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277732.1
• RefSeq Size: 2412 bp
• RefSeq ORF: 663 bp
• Locus ID: 8639
• UniProt ID: Q16853
• Cytogenetics: 17q21.31
• Protein Families: Transmembrane
• Protein Pathways: beta-Alanine metabolism, Glycine, serine and threonine metabolism, Metabolic pathways, Phenylalanine metabolism, Tyrosine metabolism
• MW: 24.5 kDa
• Gene Summary: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
  Transcript Variant: This variant (3) contains a distinct 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.