WFDC1 (NM_001282466) Human Untagged Clone
CAT#: SC334560
WFDC1 (untagged) - Human WAP four-disulfide core domain 1 (WFDC1), transcript variant 2
"NM_001282466" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WFDC1 |
Synonyms | PS20 |
Vector | pCMV6-Entry |
Sequence Data |
>SC334560 representing NM_001282466.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCTTTAACCGGCGTGGGGCCGGGCAGCTGCAGGAGGCAGATCATCCGGGCTCTGTGCCTCTTGCTA CTTCTCCTCCACGCCGGCTCTGCCAAGAATATCTGGAAACGGGCATTGCCTGCGAGGCTGGCCGAGAAA TCCCGTGCCGAGGAGGCGGGCGCGCCCGGCGGCCCCCGGCAGCCCCGAGCAGACCGCTGCCCGCCGCCT CCGCGGACGCTGCCCCCCGGCGCCTGCCAGGCCGCGCGCTGTCAGGCGGACTCCGAGTGCCCGCGGCAC CGGCGCTGCTGCTACAACGGATGCGCCTACGCCTGCCTAGAAGCTGTGCCGCCCCCGCCAGTCTTAGAC TGGCTGGTGCAGCCGAAACCTCGATGGCTTGGTGGCAATGGCTGGCTCCTGGATGGCCCTGAGGAGGTG TTACAAGCAGAGGCGTGCAGCACCACGGAGGATGGGGCCGAACCCCTGCTCTGTCCCTCGGGCTATGAG TGCCACATCCTGAGCCCAGGTGACGTGGCCGAAGGTATCCCCAACCGTGGGCAGTGCGTCAAGCAGCGC CGGCAAGCAGATGGGCGAATCCTACGACACAAACTTTACAAAGAATATCCAGAAGGTGACTCAAAGAAT GTGGCAGAACCTGGAAGGGGACAACAGAAGCACTTTCAGTAA |
Restriction Sites | SgfI-MluI Plasmid Map |
ACCN | NM_001282466 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282466.1 |
RefSeq Size | 1475 bp |
RefSeq ORF | 663 bp |
Locus ID | 58189 |
UniProt ID | Q9HC57 |
Cytogenetics | 16q24.1 |
Protein Families | Secreted Protein |
MW | 24 kDa |
Gene Summary | This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. This gene is downregulated in many cancer types and may be involved in the inhibition of cell proliferation. The encoded protein may also play a role in the susceptibility of certain CD4 memory T cells to human immunodeficiency virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (2) differs in the 3' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236666 | WFDC1 (myc-DDK-tagged) - Human WAP four-disulfide core domain 1 (WFDC1), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review