BAX (NM_001291428) Human Untagged Clone

CAT#: SC334572

BAX (untagged) - Human BCL2-associated X protein (BAX), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BAX
• Synonyms: BCL2L4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334572 representing NM_001291428.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATGAAGACAGGG
  GCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCC
  CTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAA
  CTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTT
  TTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTAC
  TTTGCCAGCAAACTGGTGCTCAAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGC
  TGGACATTGGACTTCCTCCGGGAGCGGCTGTTGGGCTGGATCCAAGACCAGGGTGGTTGGGGGCTGCCC
  CTGGCCGAGTCACTGAAGCGACTGATGTCCCTGTCTCCAGGACGGCCTCCTCTCCTACTTTGGGACGCC
  CACGTGGCAGACCGTGACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTCACCATCTGGAAGAAGAT
  GGGCTGAGGCCCCCAGCTGCCTTGGACTGTGTTTTTCCTCCATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001291428
• Insert Size: 666 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291428.1
• RefSeq Size: 869 bp
• RefSeq ORF: 666 bp
• Locus ID: 581
• UniProt ID: Q07812
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Huntington's disease, Neurotrophin signaling pathway, p53 signaling pathway, Pathways in cancer, Prion diseases
• MW: 24.3 kDa
• Gene Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. The association and the ratio of BAX to BCL2 also determines survival or death of a cell following an apoptotic stimulus. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Dec 2019]
  Transcript Variant: This variant (1) encodes the longest isoform (1).