COMMD5 (NM_001287237) Human Untagged Clone

CAT#: SC334598

COMMD5 (untagged) - Human COMM domain containing 5 (COMMD5), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COMMD5
• Synonyms: HCARG; HT002
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334598 representing NM_001287237.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTCTGCTGTGGGGGCTGCAACTCCATACCTGCATCATCCTGGTGATAGTCACAGTGGCCGAGTGAGT
  TTCTTGGGGGCCCAGCTTCCTCCAGAGGTGGCAGCAATGGCCCGGCTACTAGGGGACCTAGACAGGAGC
  ACGTTCAGAAAGTTGCTGAAGTTTGTGGTCAGCAGCCTGCAGGGGGAGGACTGCCGAGAGGCTGTGCAG
  CGTCTTGGGGTCAGCGCCAACCTGCCGGAGGAGCAGCTGGGTGCCCTGCTGGCAGGCATGCACACACTG
  CTCCAGCAGGCCCTCCGTCTGCCCCCCACCAGCCTGAAGCCTGACACCTTCAGGGACCAGCTCCAGGAG
  CTCTGCATCCCCCAAGACCTGGTCGGGGACTTGGCCAGCGTGGTATTTGGGAGCCAGCGGCCCCTCCTT
  GATTCTGTGGCCCAGCAGCAGGGGGCCTGGCTGCCGCATGTTGCTGACTTTCGGTGGCGGGTGGATGTA
  GCAATCTCCACCAGTGCCCTGGCTCGCTCCCTGCAGCCGAGCGTCCTGATGCAGCTGAAGCTTTCAGAT
  GGGTCAGCATACCGCTTTGAGGTCCCCACAGCCAAGTTCCAGGAGCTGCGGTACAGCGTGGCCCTGGTC
  CTAAAGGAGATGGCAGATCTGGAGAAGAGGTGTGAGCGCAGACTGCAGGACTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287237
• Insert Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287237.1
• RefSeq Size: 1588 bp
• RefSeq ORF: 675 bp
• Locus ID: 28991
• UniProt ID: Q9GZQ3
• Cytogenetics: 8q24.3
• Protein Families: Druggable Genome
• MW: 24.7 kDa
• Gene Summary: May modulate activity of cullin-RING E3 ubiquitin ligase (CRL) complexes (PubMed:21778237). Negatively regulates cell proliferation. Negatively regulates cell cycle G2/M phase transition probably by transactivating p21/CDKN1A through the p53/TP53-independent signaling pathway. Involved in kidney proximal tubule morphogenesis (By similarity). Down-regulates activation of NF-kappa-B (PubMed:15799966).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) represents the longest transcript. Variants 1 through 4 encode the same protein.