SURF4 (NM_001280791) Human Untagged Clone

CAT#: SC334609

SURF4 (untagged) - Human surfeit 4 (SURF4), transcript variant 5


  "NM_001280791" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
SURF4 Rabbit Polyclonal (N-Terminus) Antibody
    • 50 ug

USD 425.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "SURF4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SURF4
Synonyms ERV29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334609 representing NM_001280791.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGTTCCAGTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCC
TCGTCCTTCGTCTTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTC
GTGCAGTACGCCTGCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGG
GACTTGAAGTTTTTGATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTCCTAGCAGAATCCCGT
TCTGAAGGGAAGAGCATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCCAAACAGTACATGCAG
CTCGGAGGCAGGGTCTTGCTGGTTCTGATGTTCATGACCCTCCTTCACTTTGACGCCAGCTTCTTTTCT
ATTGTCCAGAACATCGTGGGCACAGCTCTGATGATTTTAGTGGCCATTGGTTTTAAAACCAAGCTGGCT
GCTTTGACTCTTGTTGTGTGGCTCTTTGCCATCAACGTATATTTCAACGCCTTCTGGACCATTCCAGTC
TACAAGCCCATGCATGACTTCCTGAAATACGACTTCTTCCAGACCATGTCGGTGATTGGGGGCTTGCTC
CTGGTGGTGGCCCTGGGCCCTGGGGGTGTCTCCATGGATGAGAAGAAGAAGGAGTGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001280791
Insert Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001280791.1
RefSeq Size 3166 bp
RefSeq ORF 681 bp
Locus ID 6836
Cytogenetics 9q34.2
Protein Families Transmembrane
MW 25.5 kDa
Gene Summary This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5) uses an alternate splice site in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. Both variants 4 and 5 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.