ARL6IP4 (NM_001278380) Human Untagged Clone

CAT#: SC334613

ARL6IP4 (untagged) - Human ADP-ribosylation factor-like 6 interacting protein 4 (ARL6IP4), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARL6IP4
• Synonyms: SFRS20; SR-25; SRp25; SRrp37
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334613 representing NM_001278380.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTCACGTCGGCTCCCGCAAGCGCTCGAGGAGTCGCAGCCGGTCCCGGGGACGGGGGTCGGAAAAG
  AGAAAGAAGAAGAGCAGGAAAGACACCTCGAGGAACTGCTCGGCCTCCACATCCCAAGCCTCACCTTCT
  CCCTGCATCACAGAGAGAAGCAAGCAGAAGGCCCGGAGGAGAACAAGATCCAGCTCCTCCTCCTCTTCT
  TCCAGTTCTTCTAGCTCCTCTTCTTCCTCCTCGTCCTCCTCCTCTTCCTCCAGTGATGGCCGGAAGAAG
  CGGGGGAAGTACAAGGACAAGAGGAGGAAGAAGAAGAAGAAGAGGAAGAAGCTGAAGAAGAAGGGCAAG
  GAGAAGGCGGAAGCACAGCAGGTGGAGGCTCTGCCGGGCCCCTCGCTGGACCAGTGGCACCGATCAGCT
  GGGGAGGAAGAGGATGGCCCAGTCCTGACGGATGAGCAGAAGTCCCGAATCCAGGCCATGAAGCCCATG
  ACCAAGGAGGAGTGGGATGCCCGGCAGAGCATCATCCGCAAGGTGGTGGACCCTGAGACGGGGCGCACC
  AGGCTTATTAAGGGAGATGGCGAGGTCCTAGAGGAAATCGTAACCAAAGAACGACACAGAGAGATCAAC
  AAGCAAGCCACCCGAGGGGACTGCCTGGCCTTCCAGATGCGAGCTGGGTTGCTTCCCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278380
• Insert Size: 681 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278380.1
• RefSeq Size: 1766 bp
• RefSeq ORF: 681 bp
• Locus ID: 51329
• UniProt ID: Q66PJ3
• Cytogenetics: 12q24.31
• MW: 25.3 kDa
• Gene Summary: Involved in modulating alternative pre-mRNA splicing with either 5' distal site activation or preferential use of 3' proximal site. In case of infection by Herpes simplex virus (HSVI), may act as a splicing inhibitor of HSVI pre-mRNA.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (7) has two alternate splice sites, one of which results in a downstream start codon, compared to variant 1. The resulting isoform (7) has a shorter N-terminus and lacks an internal segment, compared to isoform 1.