SLC25A45 (NM_001300820) Human Untagged Clone

CAT#: SC334614

SLC25A45 (untagged) - Human solute carrier family 25, member 45 (SLC25A45), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC25A45
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334614 representing NM_001300820.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCGGTGGAGGAATTTGTGGCTGGCTGGATCTCTGGCGCTCTGGGCTTGGTCCTGGGACACCCGTTT
  GACACTGTAAAGGTGAGGCTGCAGACCCAGACCACCTACCGGGGCATCGTTGATTGCATGGTCAAGATT
  TACCGCCATGAGTCCGCCTACTGTCTGGCTCCTTTTGACCTCATCAAAGTCCGGCTACAAAACCAGACA
  GAGCCAAGGGCCCAGCCAGGGAGCCCCCCACCCCGGTACCAGGGGCCCGTGCACTGTGCAGCCTCCATC
  TTCCGGGAGGAGGGGCCCCGGGGGCTGTTCCGAGGAGCCTGGGCCCTGACGCTGAGGGACACCCCCACG
  GTGGGGATCTACTTCATCACCTATGAAGGGCTCTGTCGCCAGTACACACCAGAAGGCCAGAATCCCAGC
  TCAGCCACGGTGCTGGTGGCAGGGGGCTTTGCAGGCATTGCTTCCTGGGTGGCAGCCACGCCCTTAGAC
  GTGATCAAGTCCCGGATGCAGATGGATGGACTGAGACGCAGAGTGTACCAGGGGATGCTGGACTGCATG
  GTGAGCAGCATCCGGCAGGAAGGACTGGGAGTCTTCTTCCGGGGGGTCACCATCAACAGTGCCCGCGCC
  TTTCCCGTCAATGCTGTCACCTTCCTCAGCTACGAATATCTCCTCCGCTGGTGGGGATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300820
• Insert Size: 681 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300820.1
• RefSeq Size: 2349 bp
• RefSeq ORF: 681 bp
• Locus ID: 283130
• UniProt ID: Q8N413
• Cytogenetics: 11q13.1
• Protein Families: Druggable Genome, Transmembrane
• MW: 25.2 kDa
• Gene Summary: SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (5) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (d) has the same N- and C-termini but is shorter compared to isoform a.