Regucalcin (RGN) (NM_001282849) Human Untagged Clone

CAT#: SC334617

RGN (untagged) - Human regucalcin (RGN), transcript variant 4


  "NM_001282849" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RGN
Synonyms GNL; HEL-S-41; RC; SMP30
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334617 representing NM_001282849.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTTCCATTAAGATTGAGTGTGTTTTGCCAGAGAACTGCCGGTGTGGTGAGTCTCCAGTATGGGAG
GAAGTGTCCAACTCTCTGCTCTTTGTAGACATTCCTGCAAAAAAGGTTTGCCGGTGGGATTCATTCACC
AAGCAAGTACAGCGAGTGACCATGGATGCCCCAGTCAGCTCCGTGGCTCTTCGCCAGTCGGGAGGCTAT
GTTGCCACCATTGGAACAAAGTTCTGTGCTTTGAACTGGAAAGAACAATCAGCAGTTGTCTTGGCCACG
GTGGATAACGACAAGAAAAACAATCGCTTCAATGATGGGAAGGTGGATCCCGCCGGGAGGTACTTTGCT
GCCAACCGCAGAAGTGTTTACAAGCTAGAAAAGGAAGAACAAATCCCAGATGGAATGTGTATTGATGCT
GAGGGGAAGCTCTGGGTGGCCTGTTACAATGGAGGAAGAGTGATTCGTTTAGATCCTGTGACAGGGAAA
AGACTTCAAACTGTGAAGTTGCCTGTTGATAAAACAACTTCATGCTGCTTTGGAGGGAAGAATTACTCT
GAAATGTATGTGACCTGCGCCCGGGATGGGATGGACCCCGAGGGTCTTTTGAGGCAACCTGAAGCTGGT
GGAATTTTCAAGATAACTGGTCTGGGGGTCAAAGGAATTGCTCCCTACTCCTATGCGGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282849
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282849.1
RefSeq Size 2041 bp
RefSeq ORF 684 bp
Locus ID 9104
UniProt ID Q15493
Cytogenetics Xp11.3
MW 25 kDa
Gene Summary The protein encoded by this gene is a highly conserved, calcium-binding protein, that is preferentially expressed in the liver and kidney. It may have an important role in calcium homeostasis. Studies in rat indicate that this protein may also play a role in aging, as it shows age-associated down-regulation. This gene is part of a gene cluster on chromosome Xp11.3-Xp11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 5' coding region, compared to variant 2. It encodes isoform 3, which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.