PRMT2 (NM_001286678) Human Untagged Clone

CAT#: SC334622

PRMT2 (untagged) - Human protein arginine methyltransferase 2 (PRMT2), transcript variant 8


  "NM_001286678" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
PRMT2 mouse monoclonal antibody, clone OTI3A3 (formerly 3A3)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PRMT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRMT2
Synonyms HRMT1L1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334622 representing NM_001286678.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAACATCAGGTGACTGTCCCAGAAGTGAATCGCAGGGAGAAGAGCCTGCTGAGTGCAGTGAGGCC
GGTCTCCTGCAGGAGGGAGTACAGCCAGAGGAGTTTGTGGCCATCGCGGACTACGCTGCCACCGATGAG
ACCCAGCTCAGTTTTTTGAGAGGAGAAAAAATTCTTATCCTGAGACAAACCACTGCAGATTGGTGGTGG
GGTGAGCGTGCGGGCTGCTGTGGGTACATTCCGGCAAACCATGTGGGGAAGCACGTGGATGAGTACGAC
CCCGAGGACACGTGGCAGGATGAAGAGTACTTCGGCAGCTATGGAACTCTGAAACTCCACTTGGAGATG
TTGGCAGACCAGCCACGAACAACTAAATACCACAGTGTCATCCTGCAGAATAAAGAATCCCTGACGGAT
AAAGTCATCCTGGACGTGGGCTGTGGGACTGGGATCATCAGTCTCTTCTGTGCACACTATGCGCGGCCT
AGAGCGGTGTACGCGGTGGAGGCCAGTGAGATGGCACAGCACACGGGGCAGCTGGTCCTGCAGAACGGC
TTTGCTGACATCATCACCGTGTACCAGCAGAAGGTGGAGGATGTGGTGCTGCCCGAGAAGGTGGACGTG
CTGGTGTCTGAGTGGATGGGGACCTGCCTGCTGGTTGGAGAAAAAGTCTTCCCCATCTGGAGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001286678
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286678.1
RefSeq Size 1722 bp
RefSeq ORF 687 bp
Locus ID 3275
UniProt ID P55345
Cytogenetics 21q22.3
Protein Families Druggable Genome
MW 25.5 kDa
Gene Summary Arginine methyltransferase that methylates the guanidino nitrogens of arginyl residues in proteins such as STAT3, FBL, histone H4. Acts as a coactivator (with NCOA2) of the androgen receptor (AR)-mediated transactivation. Acts as a coactivator (with estrogen) of estrogen receptor (ER)-mediated transactivation. Enhances PGR, PPARG, RARA-mediated transactivation. May inhibit NF-kappa-B transcription and promote apoptosis. Represses E2F1 transcriptional activity (in a RB1-dependent manner). May be involved in growth regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (8) differs in the 5' UTR and lacks 4 consecutive exons in the 3' coding region compared to variant 1. However, it maintains the reading frame and encodes a shorter isoform (7) lacking an internal protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.