RTF2 (NM_001283037) Human Untagged Clone

CAT#: SC334639

RTFDC1 (untagged) - Human replication termination factor 2 domain containing 1 (RTFDC1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RTF2
• Synonyms: C20orf43; CDAO5; HSPC164; RTFDC1; SHUJUN-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334639 representing NM_001283037.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGTTGCGACGGGGGAACAATCCCCAAGAGGCATGAACTGGTGAAGGGGCCGAAGAAGGTTGAGAAG
  GTCGACAAAGATGCTGAATTAGTGGCCCAATGGAACTATTGTACTCTAAGTCAGGAAATATTAAGACGA
  CCAATAGTTGCCTGTGAACTTGGCAGACTTTATAACAAAGATGCCGTCATTGAATTTCTCTTGGACAAA
  TCTGCAGAAAAGGCTCTTGGGAAGGCAGCATCTCACATTAAAAGCATTAAGAATGTGACAGAGCTGAAG
  CTTTCTGATAATCCTGCCTGGGAAGGGGATAAAGGAAACACTAAAGGTGACAAGCACGATGACCTCCAG
  CGGGCGCGTTTCATCTGCCCCGTTGTGGGCCTGGAGATGAACGGCCGACACAGGTTCTGCTTCCTTCGG
  TGCTGCGGCTGTGTGTTTTCTGAGCGAGCCTTGAAAGAGATAAAAGCGGAAGTTTGCCACACGTGTGGG
  GCTGCCTTCCAGGAGGATGATGTCATCATGCTCAATGGCACCAAGGAGGATGTGGACGTGCTGAAGACA
  AGGATGGAGGAGAGAAGGCTGAGAGCGAAGCTGGAAAAGAAGCCCCAGGGCCATCAAAAGTTAAGACAG
  GGAAGCCTGAAGAAGCCAGCCTTGATTCTAGAGAGAAGAAAACCAACTTGGCTCCCAAAAGCACAGCAA
  TGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001283037
• Insert Size: 693 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001283037.1
• RefSeq Size: 1617 bp
• RefSeq ORF: 693 bp
• Locus ID: 51507
• UniProt ID: Q9BY42
• Cytogenetics: 20q13.31
• MW: 26.1 kDa
• Gene Summary: Replication termination factor which is a component of the elongating replisome (Probable). Required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication. Might function to facilitate fork pausing at replication fork barriers like the rDNA. May be globally required to stimulate ATR signaling after the fork stalls or encounters a lesion (Probable). Interacts with nascent DNA (PubMed:29290612).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 5' coding region, and lacks an alternate exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a.