EIF4EL3 (EIF4E2) (NM_001276336) Human Untagged Clone

CAT#: SC334676

EIF4E2 (untagged) - Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EIF4E2
• Synonyms: 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334676 representing NM_001276336.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGACCATGATCAGAATGAAGAAAACAGC
  ACACAGAAAGATGGTGAGAAGGAAAAAACGGAACGAGACAAGAATCAGAGCAGTAGCAAGAGAAAGGCT
  GTTGTCCCTGGACCGGCAGAGCATCCCCTGCAGTACAACTACACTTTTTGGTACTCCAGGAGAACCCCC
  GGCCGTCCCACGAGCTCACAGAGCTATGAACAGAATATCAAACAGATTGGCACCTTTGCCTCTGTGGAG
  CAGTTCTGGAGGTTTTATAGCCACATGGTACGTCCTGGGGACCTGACAGGCCACAGTGACTTCCATCTC
  TTCAAAGAAGGAATTAAACCCATGTGGGAGGATGATGCAAATAAAAATGGTGGCAAGTGGATTATTCGG
  CTGCGGAAGGGCTTGGCCTCCCGTTGCTGGGAGAATCTCATTTTGGCCATGCTGGGGGAACAGTTCATG
  GTTGGGGAGGAGATCTGTGGGGCTGTGGTGTCTGTCCGCTTTCAGGAAGACATTATTTCAATATGGAAT
  AAGACTGCCAGTGACCAAGCAACCACAGCCCGAATCCGGGACACACTTCGGCGAGTGCTTAACCTACCT
  CCCAACACCATTATGGAATACAAAACTCACACCGACAGCATCAAGGACAATTCAAGCTTTCGAAATACA
  AAAATCACATTGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001276336
• Insert Size: 705 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276336.1
• RefSeq Size: 3551 bp
• RefSeq ORF: 705 bp
• Locus ID: 9470
• UniProt ID: O60573
• Cytogenetics: 2q37.1
• Protein Families: Transcription Factors
• Protein Pathways: Insulin signaling pathway, mTOR signaling pathway
• MW: 27 kDa
• Gene Summary: Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:9582349, PubMed:17368478, PubMed:25624349). Acts as a repressor of translation initiation (PubMed:22751931). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate 3' terminal exon and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (C) has a distinct C-terminus and is shorter than isoform A.