KCNMB2 (NM_001278911) Human Untagged Clone

CAT#: SC334680

KCNMB2 (untagged) - Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNMB2
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334680 representing NM_001278911.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTTTATATGGACCAGTGGCCGGACCTCTTCATCTTATAGACATGATGAAAAAAGAAATATTTACCAG
  AAAATCAGGGACCATGACCTCCTGGACAAAAGGAAAACAGTCACAGCACTGAAGGCAGGAGAGGACCGA
  GCTATTCTCCTGGGACTGGCTATGATGGTGTGCTCCATCATGATGTATTTTCTGCTGGGAATCACACTC
  CTGCGCTCATACATGCAGAGCGTGTGGACCGAAGAGTCTCAATGCACCTTGCTGAATGCGTCCATCACG
  GAAACATTTAATTGCTCCTTCAGCTGTGGTCCAGACTGCTGGAAACTTTCTCAGTACCCCTGCCTCCAG
  GTGTACGTTAACCTGACTTCTTCCGGGGAAAAGCTCCTCCTCTACCACACAGAAGAGACAATAAAAATC
  AATCAGAAGTGCTCCTATATACCTAAATGTGGAAAAAATTTTGAAGAATCCATGTCCCTGGTGAATGTT
  GTCATGGAAAACTTCAGGAAGTATCAACACTTCTCCTGCTATTCTGACCCAGAAGGAAACCAGAAGAGT
  GTTATCCTAACAAAACTCTACAGTTCCAACGTGCTGTTCCATTCACTCTTCTGGCCAACCTGTATGATG
  GCTGGGGGTGTGGCAATTGTTGCCATGGTGAAACTTACACAGTACCTCTCCCTACTATGTGAGAGGATC
  CAACGGATCAATAGATAA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278911
• Insert Size: 708 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278911.1
• RefSeq Size: 2569 bp
• RefSeq ORF: 708 bp
• Locus ID: 10242
• UniProt ID: Q9Y691
• Cytogenetics: 3q26.32
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Protein Pathways: Vascular smooth muscle contraction
• MW: 27.1 kDa
• Gene Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which decreases the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants of this gene. Additional variants are discussed in the literature, but their full length nature has not been described. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.