FRA1 (FOSL1) (NM_001300844) Human Untagged Clone

CAT#: SC334685

FOSL1 (untagged) - Human FOS-like antigen 1 (FOSL1), transcript variant 2


  "NM_001300844" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Anti-FOSL1 (FRA1) mouse monoclonal antibody, clone OTI12F9 (formerly 12F9)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "FOSL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FOSL1
Synonyms FRA; fra-1; FRA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334685 representing NM_001300844.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAG
CCCCCGGCCGCAGCGCAGGCAGCCCAGCAGAAGTTCCACCTGGTGCCAAGCATCAACACCATGAGTGGC
AGTCAGGAGCTGCAGTGGATGGTACAGCCTCATTTCCTGGGGCCCAGCAGTTACCCCAGGCCTCTGACC
TACCCTCAGTACAGCCCCCCACAACCCCGGCCAGGAGTCATCCGGGCCCTGGGGCCGCCTCCAGGGGTA
CGTCGAAGGCCTTGTGAACAGGAGACTGACAAACTGGAAGATGAGAAATCTGGGCTGCAGCGAGAGATT
GAGGAGCTGCAGAAGCAGAAGGAGCGCCTAGAGCTGGTGCTGGAAGCCCACCGACCCATCTGCAAAATC
CCGGAAGGAGCCAAGGAGGGGGACACAGGCAGTACCAGTGGCACCAGCAGCCCACCAGCCCCCTGCCGC
CCTGTACCTTGTATCTCCCTTTCCCCAGGGCCTGTGCTTGAACCTGAGGCACTGCACACCCCCACACTC
ATGACCACACCCTCCCTAACTCCTTTCACCCCCAGCCTGGTCTTCACCTACCCCAGCACTCCTGAGCCT
TGTGCCTCAGCTCATCGCAAGAGTAGCAGCAGCAGCGGAGACCCATCCTCTGACCCCCTTGGCTCTCCA
ACCCTCCTCGCTTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001300844
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300844.1
RefSeq Size 1651 bp
RefSeq ORF 708 bp
Locus ID 8061
UniProt ID P15407
Cytogenetics 11q13.1
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Wnt signaling pathway
MW 25 kDa
Gene Summary The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.